Accn4 | GeneID:63882 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 63882 Official Symbol Accn4
Locus N/A Gene Type protein-coding
Synonyms Asic4; Spasic
Full Name amiloride-sensitive cation channel 4, pituitary
Description amiloride-sensitive cation channel 4, pituitary
Chromosome 9q33
Also Known As acid-sensing ion channel 4; amiloride-sensitive cation channel 4; putative acid-sensing ion channel
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11166

ID Symbol Protein Species
GeneID:55515 ACCN4 NP_061144.2 Homo sapiens
GeneID:63882 Accn4 NP_071570.1 Rattus norvegicus
GeneID:174069 degenerin NP_495302.2 Caenorhabditis elegans
GeneID:241118 Accn4 NP_898843.1 Mus musculus
GeneID:407667 accn4b NP_999951.1 Danio rerio
GeneID:407668 accn4a NP_999952.1 Danio rerio
GeneID:488537 ACCN4 XP_853306.1 Canis lupus familiaris
GeneID:743548 ACCN4 XP_001163732.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65700 ACCN4 antibody (ab65700); Rabbit polyclonal to ACCN4
2 sigma S1072 Anti-Sodium Channel ASIC4 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022234  UCSC Browser NP_071570

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000027135 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSRNOT00000027135 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSRNOT00000027135 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSRNOT00000027135 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSRNOT00000027135 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSRNOT00000027135 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSRNOT00000027135 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSRNOT00000027135 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSRNOT00000027135 MI0005517 mmu-miR-568 AUGUAUAAAUGUAUACACAC
ENSRNOT00000027135 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSRNOT00000027135 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSRNOT00000027135 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSRNOT00000027135 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSRNOT00000027135 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSRNOT00000027135 MI0000842 rno-miR-10b CCCUGUAGAACCGAAUUUGUGU
ENSRNOT00000027135 MI0000959 rno-miR-219-1-3p AGAGUUGCGUCUGGACGUCCCG
ENSRNOT00000027135 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000027135 MI0000863 rno-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENSRNOT00000027135 MI0000862 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000027135 MI0000864 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000027135 MI0000865 rno-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSRNOT00000027135 MI0000602 rno-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSRNOT00000027135 MI0000608 rno-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSRNOT00000027135 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSRNOT00000027135 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENSRNOT00000027135 MI0003486 rno-miR-370 GCCUGCUGGGGUGGAACCUGGUU
ENSRNOT00000027135 MI0003485 rno-miR-483 UCACUCCUCCCCUCCCGUCUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050
  2. [ + ] Grunder S, et al. (2000) "A new member of acid-sensing ion channels from pituitary gland." Neuroreport. 11(8):1607-1611. PMID:10852210
  3. [ + ] Akopian AN, et al. (2000) "A new member of the acid-sensing ion channel family." Neuroreport. 11(10):2217-2222. PMID:10923674