Accn4 | GeneID:63882 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 63882 | Official Symbol | Accn4 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | Asic4; Spasic | ||
| Full Name | amiloride-sensitive cation channel 4, pituitary | ||
| Description | amiloride-sensitive cation channel 4, pituitary | ||
| Chromosome | 9q33 | ||
| Also Known As | acid-sensing ion channel 4; amiloride-sensitive cation channel 4; putative acid-sensing ion channel | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 11166
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:55515 | ACCN4 | NP_061144.2 | Homo sapiens |
| GeneID:63882 | Accn4 | NP_071570.1 | Rattus norvegicus |
| GeneID:174069 | degenerin | NP_495302.2 | Caenorhabditis elegans |
| GeneID:241118 | Accn4 | NP_898843.1 | Mus musculus |
| GeneID:407667 | accn4b | NP_999951.1 | Danio rerio |
| GeneID:407668 | accn4a | NP_999952.1 | Danio rerio |
| GeneID:488537 | ACCN4 | XP_853306.1 | Canis lupus familiaris |
| GeneID:743548 | ACCN4 | XP_001163732.1 | Pan troglodytes |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005216 | Function | ion channel activity |
| GO:0005272 | Function | sodium channel activity |
| GO:0031402 | Function | sodium ion binding |
| GO:0006811 | Process | ion transport |
| GO:0006814 | Process | sodium ion transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000027135 | MI0003559 | hsa-miR-554 | GCUAGUCCUGACUCAGCCAGU |
| ENSRNOT00000027135 | MI0003590 | hsa-miR-583 | CAAAGAGGAAGGUCCCAUUAC |
| ENSRNOT00000027135 | MI0003599 | hsa-miR-589 | UGAGAACCACGUCUGCUCUGAG |
| ENSRNOT00000027135 | MI0003609 | hsa-miR-597 | UGUGUCACUCGAUGACCACUGU |
| ENSRNOT00000027135 | MI0003611 | hsa-miR-599 | GUUGUGUCAGUUUAUCAAAC |
| ENSRNOT00000027135 | MI0003657 | hsa-miR-642 | GUCCCUCUCCAAAUGUGUCUUG |
| ENSRNOT00000027135 | MI0002404 | mmu-miR-469 | UGCCUCUUUCAUUGAUCUUGGUGUCC |
| ENSRNOT00000027135 | MI0005515 | mmu-miR-504 | AGACCCUGGUCUGCACUCUAUC |
| ENSRNOT00000027135 | MI0005517 | mmu-miR-568 | AUGUAUAAAUGUAUACACAC |
| ENSRNOT00000027135 | MI0005520 | mmu-miR-654-3p | UAUGUCUGCUGACCAUCACCUU |
| ENSRNOT00000027135 | MI0004196 | mmu-miR-667 | UGACACCUGCCACCCAGCCCAAG |
| ENSRNOT00000027135 | MI0004134 | mmu-miR-668 | UGUCACUCGGCUCGGCCCACUACC |
| ENSRNOT00000027135 | MI0004295 | mmu-miR-670 | AUCCCUGAGUGUAUGUGGUGAA |
| ENSRNOT00000027135 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENSRNOT00000027135 | MI0000842 | rno-miR-10b | CCCUGUAGAACCGAAUUUGUGU |
| ENSRNOT00000027135 | MI0000959 | rno-miR-219-1-3p | AGAGUUGCGUCUGGACGUCCCG |
| ENSRNOT00000027135 | MI0000967 | rno-miR-296 | GAGGGUUGGGUGGAGGCUCUCC |
| ENSRNOT00000027135 | MI0000863 | rno-miR-29a | UAGCACCAUCUGAAAUCGGUUA |
| ENSRNOT00000027135 | MI0000862 | rno-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSRNOT00000027135 | MI0000864 | rno-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSRNOT00000027135 | MI0000865 | rno-miR-29c | UAGCACCAUUUGAAAUCGGUUA |
| ENSRNOT00000027135 | MI0000602 | rno-miR-328 | CUGGCCCUCUCUGCCCUUCCGU |
| ENSRNOT00000027135 | MI0000608 | rno-miR-331 | GCCCCUGGGCCUAUCCUAGAA |
| ENSRNOT00000027135 | MI0000613 | rno-miR-336 | UCACCCUUCCAUAUCUAGUCU |
| ENSRNOT00000027135 | MI0000636 | rno-miR-349 | CAGCCCUGCUGUCUUAACCUCU |
| ENSRNOT00000027135 | MI0003486 | rno-miR-370 | GCCUGCUGGGGUGGAACCUGGUU |
| ENSRNOT00000027135 | MI0003485 | rno-miR-483 | UCACUCCUCCCCUCCCGUCUUGU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050 - [
] Grunder S, et al. (2000) "A new member of acid-sensing ion channels from pituitary gland." Neuroreport. 11(8):1607-1611. PMID:10852210 - [
] Akopian AN, et al. (2000) "A new member of the acid-sensing ion channel family." Neuroreport. 11(10):2217-2222. PMID:10923674
Acid-sensing ion channels (ASICs) are widely expressed in mammalian sensory neurons and supposedly play a role in nociception and acid sensing. In the course of functioning the redox status of the tissue is subjected to changes. Using whole-cell patch-clamp/concentration clamp techniques we have investigated the effect of redox reagents on the ASIC-like currents in the sensory ganglia and hippocampal neurons of rat. The reducing agent dithiothreitol (DTT), when applied in the concentrations 1-2 mM, reversibly potentiates proton-activated currents, while the oxidizing reagent 5,5'-dithio-bis-(2-nitrobenzoic acid) (DTNB) causes their inhibition. The EC50 and Hill coefficient for the activation of ASIC-like currents by protons are not affected by DTT. Redox modulation of proton-activated currents is independent on the membrane potential and on the level of pH used for the current activation. The endogenous antioxidant tripeptide glutathione (its reduced form, g-l-glutamyl-l-cysteinyl-glycine, GSH) also potentiates proton-activated currents. Our results indicate that ASIC-like currents are susceptible to regulation by redox agents.
Acid-sensing ion channels (ASICs) constitute a branch of the super-gene family of amiloride-sensitive sodium channels. So far five different ASICs have been cloned from mammalian tissues. They are activated by a drop of extracellular pH but differ with respect to effective agonist concentration, desensitization and mRNA expression pattern. Here we report cloning of ASIC4, a new protein showing about 45% identity to other ASICs. ASIC4 is 97% identical between rat and human and shows strongest expression in pituitary gland. Moreover, we detected expression throughout the brain, in spinal cord, and inner ear. ASIC4 cannot be activated by a drop of extracellular pH in Xenopus oocytes, suggesting association with other subunits or activation by a ligand different from protons. Our results suggest a role for ASICs also in endocrine glands.
Acid-sensing ion channels (ASICs) are members of the epithelial sodium channel (ENaC)-degenerin family of two-pass transmembrane segment protein subunits which form multimeric cation channels. Members of the ENaC-degenerin family are gated by stimuli as diverse as protons, peptides and mechanical distension. Here we describe a new member of the family, SPASIC or ASIC 4 (spinal cord ASIC) which is expressed throughout the central nervous system in an overlapping population of neurons that also express the ASIC subunit MDEG2. ASIC-4 which shows 44% identify with ASIC is developmentally regulated and expressed in a subset of sensory neurons as well as in the CNS. However, despite the strong homology with ASIC, the ASIC-4 transcript does not encode a proton gated cation channel.