ABHD4 | GeneID:63874 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 63874 Official Symbol ABHD4
Locus N/A Gene Type protein-coding
Synonyms ABH4; FLJ12816
Full Name abhydrolase domain containing 4
Description abhydrolase domain containing 4
Chromosome 14q11.2
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56937

ID Symbol Protein Species
GeneID:35733 CG1882 NP_610326.1 Drosophila melanogaster
GeneID:63874 ABHD4 NP_071343.2 Homo sapiens
GeneID:105501 Abhd4 NP_598837.1 Mus musculus
GeneID:178877 C37H5.3 NP_504297.1 Caenorhabditis elegans
GeneID:183295 C37H5.2 NP_504299.2 Caenorhabditis elegans
GeneID:364380 Abhd4 XP_344404.3 Rattus norvegicus
GeneID:452784 ABHD4 XP_509839.2 Pan troglodytes
GeneID:509896 ABHD4 NP_001029540.1 Bos taurus
GeneID:550276 abhd4 NP_001017613.1 Danio rerio
GeneID:607421 ABHD4 XP_848701.1 Canis lupus familiaris
GeneID:828516 AT4G24160 NP_194147.2 Arabidopsis thaliana
GeneID:853007 YGR110W NP_011625.1 Saccharomyces cerevisiae
GeneID:1272375 AgaP_AGAP000784 XP_311323.2 Anopheles gambiae
GeneID:2542281 SPAC6G10.03c NP_594100.1 Schizosaccharomyces pombe
GeneID:2684333 MGG_06157 XP_369307.1 Magnaporthe grisea
GeneID:2708061 NCU06332.1 XP_326187.1 Neurospora crassa
GeneID:2897074 KLLA0B12914g XP_452106.1 Kluyveromyces lactis
GeneID:4347605 Os09g0520200 NP_001063697.1 Oryza sativa
GeneID:4619020 AGOS_ABL019W NP_982928.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris AP08982PU-N ABHD4 (Internal); antibody Ab
2 sigma HPA000600 Anti-ABHD4 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0016787 Function hydrolase activity
GO:0016042 Process lipid catabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022060  UCSC Browser NP_071343

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000216327 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000216327 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000216327 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000216327 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000216327 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000216327 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000216327 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000216327 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased expression of ABHD4 mRNA
16788091
Acetaminophen
  • Acetaminophen affects the expression of ABHD4 mRNA
17562736
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABHD4 mRNA
17555576
pirinixic acid
  • pirinixic acid results in increased expression of ABHD4 mRNA
18301758, 17426115
Tamoxifen
  • Tamoxifen affects the expression of ABHD4 mRNA
17555576

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 16818667, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 11161223, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 17333356, 16105132, 11677210, 15861022, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 17562736, 16081117, 14986274, 16227642, 15968718, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Simon GM, et al. (2006) "Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta-hydrolase 4 in this pathway." J Biol Chem. 281(36):26465-26472. PMID:16818490
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932