AANAT | GeneID:618594 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 618594 Official Symbol AANAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylalkylamine N-acetyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_870926 XP_876019

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000019543 MI0004759 bta-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSBTAT00000019543 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSBTAT00000019543 MI0005020 bta-miR-369-5p AUCGACCGUGUUAUAUUCGC
ENSBTAT00000019543 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSBTAT00000019543 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000019543 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSBTAT00000019543 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSBTAT00000019543 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSBTAT00000019543 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSBTAT00000019543 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSBTAT00000019543 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSBTAT00000019543 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSBTAT00000019543 MI0005561 hsa-miR-877 GUAGAGGAGAUGGCGCAGGG
ENSBTAT00000019543 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSBTAT00000019543 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSBTAT00000019543 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSBTAT00000034708 MI0004738 bta-miR-151* UCGAGGAGCUCACAGUCUAGU
ENSBTAT00000034708 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSBTAT00000034708 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSBTAT00000034708 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSBTAT00000034708 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSBTAT00000034708 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSBTAT00000034708 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSBTAT00000034708 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSBTAT00000034708 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSBTAT00000034708 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSBTAT00000034708 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000034708 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000034708 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000034708 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSBTAT00000034708 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSBTAT00000034708 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_870926  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]