ABCC4 | GeneID:616707 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 616707 Official Symbol ABCC4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 114252

ID Symbol Protein Species
GeneID:34148 CG7627 NP_609215.3 Drosophila melanogaster
GeneID:35366 CG9270 NP_995741.1 Drosophila melanogaster
GeneID:41387 CG14709 NP_650086.1 Drosophila melanogaster
GeneID:42362 CG4562 NP_650838.1 Drosophila melanogaster
GeneID:326161 CG31793 NP_609930.4 Drosophila melanogaster
GeneID:509854 LOC509854 XP_586909.3 Bos taurus
GeneID:520016 LOC520016 XP_598247.3 Bos taurus
GeneID:521568 LOC521568 XP_599833.3 Bos taurus
GeneID:523938 LOC523938 XP_602249.3 Bos taurus
GeneID:524700 LOC524700 XP_603032.3 Bos taurus
GeneID:530437 LOC530437 XP_608909.3 Bos taurus
GeneID:531645 LOC531645 XP_610144.3 Bos taurus
GeneID:616707 ABCC4 XP_873894.2 Bos taurus
GeneID:617079 LOC617079 XP_874355.2 Bos taurus
GeneID:617150 LOC617150 XP_874442.2 Bos taurus
GeneID:1277037 AgaP_AGAP006427 XP_557101.1 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0005254 Function chloride channel activity
GO:0000166 Function nucleotide binding
GO:0006811 Process ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_868801 XP_873894

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000010182 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSBTAT00000010182 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSBTAT00000010182 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000010182 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENSBTAT00000010182 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSBTAT00000010182 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSBTAT00000010182 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSBTAT00000010182 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSBTAT00000010182 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene