ABHD14B | GeneID:615289 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 615289 Official Symbol ABHD14B
Locus N/A Gene Type protein-coding
Synonyms MGC155104
Full Name N/A
Description abhydrolase domain containing 14B
Chromosome N/A
Also Known As Abhydrolase domain-containing protein 14B
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9125

ID Symbol Protein Species
GeneID:76491 Abhd14b NP_083907.2 Mus musculus
GeneID:84836 ABHD14B NP_116139.1 Homo sapiens
GeneID:300983 Abhd14b NP_001007665.1 Rattus norvegicus
GeneID:393338 zgc:64031 NP_956661.1 Danio rerio
GeneID:460411 ABHD14B XP_516497.2 Pan troglodytes
GeneID:484744 ABHD14B XP_541860.2 Canis lupus familiaris
GeneID:615289 ABHD14B XP_872147.2 Bos taurus
GeneID:100002339 LOC100002339 XP_001342146.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001105441 NP_001098911

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000024782 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000024782 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000024782 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSBTAT00000024782 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSBTAT00000024782 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSBTAT00000024782 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSBTAT00000024782 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000024782 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000024782 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSBTAT00000024782 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSBTAT00000024782 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSBTAT00000024782 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSBTAT00000024782 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSBTAT00000024782 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENSBTAT00000024782 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSBTAT00000024782 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSBTAT00000024782 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSBTAT00000024782 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSBTAT00000024782 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSBTAT00000024782 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene