A1CF | GeneID:613704 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 613704 Official Symbol A1CF
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description APOBEC1 complementation factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_864746 XP_869839

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000033157 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSBTAT00000033157 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSBTAT00000033157 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSBTAT00000033157 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSBTAT00000033157 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSBTAT00000033157 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSBTAT00000033157 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSBTAT00000033157 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000033157 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000033157 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000033157 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSBTAT00000033157 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000033157 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000033157 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSBTAT00000033157 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSBTAT00000033157 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSBTAT00000033157 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSBTAT00000033157 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSBTAT00000033157 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSBTAT00000033157 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSBTAT00000033157 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSBTAT00000033157 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_864746  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene