NRN1 | GeneID:612757 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 612757 Official Symbol NRN1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description neuritin 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9577

ID Symbol Protein Species
GeneID:51299 NRN1 NP_057672.1 Homo sapiens
GeneID:68404 Nrn1 NP_705757.1 Mus musculus
GeneID:420873 NRN1 XP_418961.2 Gallus gallus
GeneID:436780 nrn1 NP_001002507.1 Danio rerio
GeneID:462412 NRN1 XP_518219.1 Pan troglodytes
GeneID:538730 NRN1 NP_001039903.1 Bos taurus
GeneID:612757 NRN1 XP_848786.1 Canis lupus familiaris

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_843693 XP_848786
2 XM_852012 XP_857105

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015082 MI0005034 bta-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSCAFT00000015082 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSCAFT00000015082 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000015082 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000015082 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000015082 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSCAFT00000015082 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSCAFT00000015082 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSCAFT00000015082 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000015082 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000015082 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000015082 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSCAFT00000015082 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSCAFT00000015082 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSCAFT00000015082 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSCAFT00000015082 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSCAFT00000015082 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSCAFT00000015082 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene