ABCD1 | GeneID:612520 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 612520 Official Symbol ABCD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55426

ID Symbol Protein Species
GeneID:215 ABCD1 NP_000024.2 Homo sapiens
GeneID:11666 Abcd1 NP_031461.1 Mus musculus
GeneID:363516 Abcd1 XP_343841.1 Rattus norvegicus
GeneID:515178 ABCD1 NP_001039655.1 Bos taurus
GeneID:566367 zgc:172102 NP_001104656.1 Danio rerio
GeneID:612520 ABCD1 XP_855341.1 Canis lupus familiaris
GeneID:2684880 MGG_06707 XP_370210.2 Magnaporthe grisea
GeneID:2709950 NCU01751.1 XP_328190.1 Neurospora crassa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_850248 XP_855341

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000030549 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000030549 MI0001651 cfa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
ENSCAFT00000030549 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSCAFT00000030549 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSCAFT00000030549 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000030549 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000030549 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSCAFT00000030549 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000030549 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSCAFT00000030549 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSCAFT00000030549 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSCAFT00000030549 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSCAFT00000030549 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSCAFT00000030549 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSCAFT00000030549 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSCAFT00000030549 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSCAFT00000030549 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSCAFT00000030549 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSCAFT00000030549 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_850248  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene