ABCA9 | GeneID:611016 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 611016 Official Symbol ABCA9
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 9
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 33332

ID Symbol Protein Species
GeneID:10350 ABCA9 NP_525022.2 Homo sapiens
GeneID:217262 Abca9 NP_671753.1 Mus musculus
GeneID:287788 Abca9 XP_221101.4 Rattus norvegicus
GeneID:504278 ABCA9 XP_870269.2 Bos taurus
GeneID:611016 ABCA9 XP_853718.1 Canis lupus familiaris
GeneID:742781 ABCA9 XP_001146190.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_848625 XP_853718

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000017398 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSCAFT00000017398 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSCAFT00000017398 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENSCAFT00000017398 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSCAFT00000017398 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSCAFT00000017398 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSCAFT00000017398 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSCAFT00000017398 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSCAFT00000017398 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSCAFT00000017398 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSCAFT00000017398 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSCAFT00000017398 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000017398 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSCAFT00000017398 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENSCAFT00000017398 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_848625  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene