ABHD12B | GeneID:610765 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 610765 Official Symbol ABHD12B
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 12B
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45643

ID Symbol Protein Species
GeneID:145447 ABHD12B NP_861535.1 Homo sapiens
GeneID:328121 Abhd12b XP_001475516.1 Mus musculus
GeneID:408202 Bem46l3 NP_001003928.1 Rattus norvegicus
GeneID:467453 ABHD12B XP_522850.2 Pan troglodytes
GeneID:555902 LOC555902 XP_683654.2 Danio rerio
GeneID:610765 ABHD12B XP_853408.1 Canis lupus familiaris
GeneID:751622 si:ch211-117n7.7 NP_001038808.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_848315 XP_853408

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000039341 MI0005009 bta-miR-139 UCUACAGUGCACGUGUCUCCAGU
ENSCAFT00000039341 MI0001647 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000039341 MI0001657 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000039341 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSCAFT00000039341 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSCAFT00000039341 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000039341 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENSCAFT00000039341 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_848315  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene