ABCG4 | GeneID:610604 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 610604 Official Symbol ABCG4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75179

ID Symbol Protein Species
GeneID:64137 ABCG4 NP_071452.2 Homo sapiens
GeneID:173671 wht-4 NP_494495.2 Caenorhabditis elegans
GeneID:192663 Abcg4 NP_620405.3 Mus musculus
GeneID:300664 Abcg4 XP_236186.2 Rattus norvegicus
GeneID:428242 ABCG4 XP_425801.2 Gallus gallus
GeneID:466802 ABCG4 XP_522202.2 Pan troglodytes
GeneID:508443 ABCG4 XP_585219.3 Bos taurus
GeneID:564842 LOC564842 XP_687685.2 Danio rerio
GeneID:610604 ABCG4 XP_853231.1 Canis lupus familiaris
GeneID:794238 abcg4b NP_001104682.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_848138 XP_853231

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000019413 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSCAFT00000019413 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSCAFT00000019413 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000019413 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000019413 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENSCAFT00000019413 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSCAFT00000019413 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSCAFT00000019413 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000019413 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSCAFT00000019413 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSCAFT00000019413 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSCAFT00000019413 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSCAFT00000019413 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSCAFT00000019413 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSCAFT00000019413 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSCAFT00000019413 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000019413 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSCAFT00000019413 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSCAFT00000019413 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSCAFT00000019413 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSCAFT00000019413 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSCAFT00000019413 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSCAFT00000019413 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_848138  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]