AADACL2 | GeneID:609872 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 609872 Official Symbol AADACL2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28634

ID Symbol Protein Species
GeneID:295076 Aadacl2 XP_227188.2 Rattus norvegicus
GeneID:344752 AADACL2 NP_997248.1 Homo sapiens
GeneID:470969 AADACL2 XP_526352.2 Pan troglodytes
GeneID:609872 AADACL2 XP_852689.1 Canis lupus familiaris
GeneID:639634 Aadacl2 XP_991278.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_847596 XP_852689
2 XM_861078 XP_866171

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000013550 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSCAFT00000013550 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSCAFT00000013550 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENSCAFT00000013550 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSCAFT00000013550 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000013550 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000013550 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000013550 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000013550 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000013550 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000013550 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSCAFT00000013550 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000013550 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000013550 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSCAFT00000013550 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSCAFT00000013550 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSCAFT00000013550 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSCAFT00000013550 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSCAFT00000013550 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSCAFT00000013550 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSCAFT00000013550 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000013550 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000013550 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000013550 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSCAFT00000013550 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSCAFT00000013550 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSCAFT00000013550 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSCAFT00000013550 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSCAFT00000013550 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSCAFT00000013550 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene