AAAS | GeneID:607867 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 607867 Official Symbol AAAS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9232

ID Symbol Protein Species
GeneID:8086 AAAS NP_056480.1 Homo sapiens
GeneID:31881 CG16892 NP_572557.1 Drosophila melanogaster
GeneID:223921 Aaas NP_700465.1 Mus musculus
GeneID:378454 aaas NP_998390.1 Danio rerio
GeneID:467003 AAAS XP_522403.2 Pan troglodytes
GeneID:506561 AAAS NP_001068737.1 Bos taurus
GeneID:607867 AAAS XP_849797.1 Canis lupus familiaris
GeneID:824857 AT3G56900 NP_191249.2 Arabidopsis thaliana
GeneID:1272488 AgaP_AGAP010685 XP_311401.2 Anopheles gambiae
GeneID:4349688 Os11g0132700 NP_001065665.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_844704 XP_849797

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000011174 MI0004753 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000011174 MI0005457 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000011174 MI0005459 bta-miR-195 UAGCAGCACAGAAAUAUUGGCA
ENSCAFT00000011174 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSCAFT00000011174 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENSCAFT00000011174 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSCAFT00000011174 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSCAFT00000011174 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSCAFT00000011174 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENSCAFT00000011174 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENSCAFT00000011174 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000011174 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSCAFT00000011174 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSCAFT00000011174 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSCAFT00000011174 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSCAFT00000011174 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSCAFT00000011174 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSCAFT00000011174 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSCAFT00000011174 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSCAFT00000011174 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENSCAFT00000011174 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000011174 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSCAFT00000011174 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSCAFT00000011174 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENSCAFT00000011174 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_844704  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene