AADACL4 | GeneID:607688 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 607688 Official Symbol AADACL4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 82530

ID Symbol Protein Species
GeneID:313688 RGD1565761 XP_233640.4 Rattus norvegicus
GeneID:343066 AADACL4 NP_001013652.1 Homo sapiens
GeneID:419479 AADACL4 XP_417635.2 Gallus gallus
GeneID:429936 LOC429936 XP_427491.2 Gallus gallus
GeneID:435815 OTTMUSG00000010747 NP_001074717.1 Mus musculus
GeneID:469815 AADACL4 XP_525200.2 Pan troglodytes
GeneID:569798 aadacl4 XP_698297.1 Danio rerio
GeneID:607688 AADACL4 XP_849554.1 Canis lupus familiaris
GeneID:768457 AADACL4 XP_001231394.1 Gallus gallus
GeneID:768489 LOC768489 XP_001231457.1 Gallus gallus
GeneID:768580 LOC768580 XP_001231604.1 Gallus gallus
GeneID:768597 LOC768597 XP_001231631.1 Gallus gallus
GeneID:768647 LOC768647 XP_001231701.1 Gallus gallus
GeneID:768668 AADACL3 XP_001231735.1 Gallus gallus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_844461 XP_849554

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000025959 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000025959 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000025959 MI0005006 bta-miR-107 AGCAGCAUUGUACAGGGCUAUC
ENSCAFT00000025959 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000025959 MI0001647 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000025959 MI0001657 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000025959 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000025959 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000025959 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSCAFT00000025959 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENSCAFT00000025959 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENSCAFT00000025959 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000025959 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000025959 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSCAFT00000025959 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSCAFT00000025959 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSCAFT00000025959 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSCAFT00000025959 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSCAFT00000025959 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSCAFT00000025959 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSCAFT00000025959 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSCAFT00000025959 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_844461  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]