ABHD4 | GeneID:607421 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 607421 Official Symbol ABHD4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56937

ID Symbol Protein Species
GeneID:35733 CG1882 NP_610326.1 Drosophila melanogaster
GeneID:63874 ABHD4 NP_071343.2 Homo sapiens
GeneID:105501 Abhd4 NP_598837.1 Mus musculus
GeneID:178877 C37H5.3 NP_504297.1 Caenorhabditis elegans
GeneID:183295 C37H5.2 NP_504299.2 Caenorhabditis elegans
GeneID:364380 Abhd4 XP_344404.3 Rattus norvegicus
GeneID:452784 ABHD4 XP_509839.2 Pan troglodytes
GeneID:509896 ABHD4 NP_001029540.1 Bos taurus
GeneID:550276 abhd4 NP_001017613.1 Danio rerio
GeneID:607421 ABHD4 XP_848701.1 Canis lupus familiaris
GeneID:828516 AT4G24160 NP_194147.2 Arabidopsis thaliana
GeneID:853007 YGR110W NP_011625.1 Saccharomyces cerevisiae
GeneID:1272375 AgaP_AGAP000784 XP_311323.2 Anopheles gambiae
GeneID:2542281 SPAC6G10.03c NP_594100.1 Schizosaccharomyces pombe
GeneID:2684333 MGG_06157 XP_369307.1 Magnaporthe grisea
GeneID:2708061 NCU06332.1 XP_326187.1 Neurospora crassa
GeneID:2897074 KLLA0B12914g XP_452106.1 Kluyveromyces lactis
GeneID:4347605 Os09g0520200 NP_001063697.1 Oryza sativa
GeneID:4619020 AGOS_ABL019W NP_982928.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_843608 XP_848701
2 XM_851608 XP_856701
3 XM_851649 XP_856742
4 XM_851691 XP_856784

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000017726 MI0005462 bta-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSCAFT00000017726 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSCAFT00000017726 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSCAFT00000017726 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSCAFT00000017726 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENSCAFT00000017726 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSCAFT00000017726 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000017726 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000017726 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSCAFT00000017726 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSCAFT00000017726 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSCAFT00000017726 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSCAFT00000017726 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000017726 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSCAFT00000017726 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene