ABCE1 | GeneID:6059 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 6059 Official Symbol ABCE1
Locus N/A Gene Type protein-coding
Synonyms ABC38; OABP; RLI; RNASEL1; RNASELI; RNS4I
Full Name ATP-binding cassette, sub-family E (OABP), member 1
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome 4q31
Also Known As ATP-binding cassette, sub-family E, member 1; RNase L inhibitor; ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) inhibitor
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab32270 ABCE1 antibody (ab32270); Rabbit polyclonal to ABCE1
2 abcam ab4688 ABCE1 antibody (ab4688); Rabbit polyclonal to ABCE1
3 acris AP16796PU-N ABCE1 (C-term); antibody Ab
4 scbt ABCE1 ABCE1 Antibody / ABCE1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCE1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCE1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0009055 Function electron carrier activity
GO:0051536 Function iron-sulfur cluster binding
GO:0000166 Function nucleotide binding
GO:0008428 Function ribonuclease inhibitor activity
GO:0044419 Process interspecies interaction between organisms
GO:0009615 Process response to virus
GO:0006401 Process RNA catabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001040876  UCSC Browser NP_001035809
2 NM_002940  UCSC Browser NP_002931

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000296577 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENST00000296577 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000296577 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000296577 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000296577 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000296577 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000296577 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000296577 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000296577 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000296577 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000296577 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENST00000296577 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCE1 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCE1 mRNA
17484886
dicyclanil
  • dicyclanil results in increased expression of ABCE1 mRNA
15664270
Docosahexaenoic Acids
  • Docosahexaenoic Acids results in increased expression of ABCE1 mRNA
16623957
Thiophenes
  • Thiophenes analog promotes the reaction [Tretinoin results in decreased expression of ABCE1 mRNA]
16140955
Tretinoin
  • Thiophenes analog promotes the reaction [Tretinoin results in decreased expression of ABCE1 mRNA]
  • Tretinoin results in decreased expression of ABCE1 mRNA
16140955
Tunicamycin
  • Tunicamycin results in increased expression of ABCE1 mRNA
17127020

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 12679006, 15748426, 16788101, 16766008, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 17107899, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Leukemia, Promyelocytic, Acute inferred via Thiophenes 16140954, 16140955
Leukemia-Lymphoma, Adult T-Cell inferred via Docosahexaenoic Acids 17077332
Liver Diseases inferred via Docosahexaenoic Acids 17056761
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 16011737, 16050911, 16097048, 15673190
Fatty Liver inferred via Carbon Tetrachloride 16045604, 17595544, 16239168, 15959796, 12795759, 61145, 12631006
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 11566570, 15998439, 15968718, 15027814, 16227642
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 16248980, 17805973, 17976157, 18395095, 12666154, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 18376398, 12389079, 18187930, 18210741, 16015684, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 16638106, 18156304, 17557913, 17525996, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 15830285, 17285989, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 16177239, 15968718, 16227642, 14986274, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
RNASEL ABCE1 / RNASEL Reconstituted Complex Bisbal C (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Smirnova EV, et al. (2008) "TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion." Virology. 372(1):10-23. PMID:18006034
  3. [ + ] Shea PR, et al. (2008) "RNASEL and RNASEL-inhibitor variation and prostate cancer risk in Afro-Caribbeans." Prostate. 68(4):354-359. PMID:18189233
  4. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  5. [ + ] Lingappa JR, et al. (2006) "Basic residues in the nucleocapsid domain of Gag are required for interaction of HIV-1 gag with ABCE1 (HP68), a cellular protein important for HIV-1 capsid assembly." J Biol Chem. 281(7):3773-3784. PMID:16275648
  6. [ + ] Desloges N, et al. (2005) "Varicella-zoster virus does not significantly induce cell defence mechanism mediated by the 2-5A/RNase L pathway during its replication cycle." Med Microbiol Immunol. 194(1-2):25-31. PMID:15107989
  7. [ + ] Shichijo S, et al. (2005) "ABCE1, a member of ATP-binding cassette transporter gene, encodes peptides capable of inducing HLA-A2-restricted and tumor-reactive cytotoxic T lymphocytes in colon cancer patients." Oncol Rep. 13(5):907-913. PMID:15809757
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Dooher JE, et al. (2004) "Conservation of a stepwise, energy-sensitive pathway involving HP68 for assembly of primate lentivirus capsids in cells." J Virol. 78(4):1645-1656. PMID:14747530
  10. [ + ] Lake JA, et al. (2003) "The role of Vif during HIV-1 infection: interaction with novel host cellular factors." J Clin Virol. 26(2):143-152. PMID:12600646
  11. [ + ] Teufel DP, et al. (2003) "Mutational analysis of the complex of human RNase inhibitor and human eosinophil-derived neurotoxin (RNase 2)." Biochemistry. 42(6):1451-1459. PMID:12578357
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Zimmerman C, et al. (2002) "Identification of a host protein essential for assembly of immature HIV-1 capsids." Nature. 415(6867):88-92. PMID:11780123
  14. [ + ] Le Roy F, et al. (2001) "The 2-5A/RNase L/RNase L inhibitor (RLI) [correction of (RNI)] pathway regulates mitochondrial mRNAs stability in interferon alpha-treated H9 cells." J Biol Chem. 276(51):48473-48482. PMID:11585831
  15. [ + ] Martinand C, et al. (1999) "RNase L inhibitor is induced during human immunodeficiency virus type 1 infection and down regulates the 2-5A/RNase L pathway in human T cells." J Virol. 73(1):290-296. PMID:9847332
  16. [ + ] Martinand C, et al. (1998) "RNase L inhibitor (RLI) antisense constructions block partially the down regulation of the 2-5A/RNase L pathway in encephalomyocarditis-virus-(EMCV)-infected cells." Eur J Biochem. 254(2):248-255. PMID:9660177
  17. [ + ] Martinand C, et al. (1998) "The RNase L inhibitor (RLI) is induced by double-stranded RNA." J Interferon Cytokine Res. 18(12):1031-1038. PMID:9877446
  18. [ + ] Aubry F, et al. (1996) "Chromosomal localization and expression pattern of the RNase L inhibitor gene." FEBS Lett. 381(1-2):135-139. PMID:8641422
  19. [ + ] Diriong S, et al. (1996) "Localization of the ribonuclease L inhibitor gene (RNS4I), a new member of the interferon-regulated 2-5A pathway, to 4q31 by fluorescence in situ hybridization." Genomics. 32(3):488-490. PMID:8838820
  20. [ + ] Bisbal C, et al. (1995) "Cloning and characterization of a RNAse L inhibitor. A new component of the interferon-regulated 2-5A pathway." J Biol Chem. 270(22):13308-13317. PMID:7539425