AASDHPPT | GeneID:60496 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 60496 Official Symbol AASDHPPT
Locus N/A Gene Type protein-coding
Synonyms AASD-PPT; CGI-80; DKFZp566E2346; LYS2; LYS5
Full Name aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Description aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Chromosome 11q22
Also Known As 4'-phosphopantetheinyl transferase; alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase
Summary The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9130

ID Symbol Protein Species
GeneID:60496 AASDHPPT NP_056238.2 Homo sapiens
GeneID:67618 Aasdhppt NP_080552.2 Mus musculus
GeneID:180425 T04G9.4 NP_508153.1 Caenorhabditis elegans
GeneID:189061 T28H10.1 NP_506135.1 Caenorhabditis elegans
GeneID:300328 Aasdhppt XP_217078.3 Rattus norvegicus
GeneID:317852 eap NP_729788.1 Drosophila melanogaster
GeneID:418975 AASDHPPT XP_417169.2 Gallus gallus
GeneID:451524 AASDHPPT XP_508734.2 Pan troglodytes
GeneID:489426 AASDHPPT XP_546544.2 Canis lupus familiaris
GeneID:519816 AASDHPPT XP_869172.1 Bos taurus
GeneID:619247 zgc:114148 NP_001028901.1 Danio rerio
GeneID:784811 AASDHPPT XP_001250766.1 Bos taurus
GeneID:4349713 Os11g0136500 NP_001065690.1 Oryza sativa
GeneID:4351429 Os12g0133400 NP_001066088.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab68316 AASDHPPT antibody (ab68316); Mouse polyclonal to AASDHPPT

Exon, Intron and UTRs

Exon, Intron and UTRs of AASDHPPT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AASDHPPT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0008897 Function holo-[acyl-carrier-protein] synthase activity
GO:0000287 Function magnesium ion binding
GO:0016740 Function transferase activity
GO:0009059 Process macromolecule biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015423  UCSC Browser NP_056238 B2R6D1   Q9NRN7  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000278618 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000278618 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000278618 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000278618 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000278618 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000278618 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000278618 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000278618 MI0000271 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU
ENST00000278618 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000278618 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENST00000278618 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000278618 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000278618 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENST00000278618 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AASDHPPT mRNA
17562736
pirinixic acid
  • pirinixic acid results in increased expression of AASDHPPT mRNA
18301758
Uranium
  • Uranium affects the expression of AASDHPPT mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of AASDHPPT mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 14986274, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
MDFI MDFI / AASDHPPT Two-hybrid Rual JF (2005)
TRAF2 TRAF2 / AASDHPPT Two-hybrid Rual JF (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Joshi AK, et al. (2003) "Cloning, expression, and characterization of a human 4'-phosphopantetheinyl transferase with broad substrate specificity." J Biol Chem. 278(35):33142-33149. PMID:12815048
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Praphanphoj V, et al. (2001) "Identification of the alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase gene, the human ortholog of the yeast LYS5 gene." Mol Genet Metab. 72(4):336-342. PMID:11286508
  6. [ + ] Lai CH, et al. (2000) "Identification of novel human genes evolutionarily conserved in Caenorhabditis elegans by comparative proteomics." Genome Res. 10(5):703-713. PMID:10810093
  7. [ + ] Zhang QH, et al. (2000) "Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells." Genome Res. 10(10):1546-1560. PMID:11042152
  8. [ + ] Hu RM, et al. (2000) "Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning." Proc Natl Acad Sci U S A. 97(17):9543-9548. PMID:10931946