ACTB | GeneID:60 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 60 Official Symbol ACTB
Locus N/A Gene Type protein-coding
Synonyms PS1TP5BP1
Full Name actin, beta
Description actin, beta
Chromosome 7p15-p12
Also Known As PS1TP5-binding protein 1; actin, cytoplasmic 1; beta actin; beta cytoskeletal actin
Summary This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 110648

ID Symbol Protein Species
GeneID:60 ACTB NP_001092.1 Homo sapiens
GeneID:11461 Actb NP_031419.1 Mus musculus
GeneID:37368 Act57B NP_523800.1 Drosophila melanogaster
GeneID:48632 Act87E NP_731812.1 Drosophila melanogaster
GeneID:81822 Actb NP_112406.1 Rattus norvegicus
GeneID:280979 ACTB NP_776404.2 Bos taurus
GeneID:396526 RCJMB04_4h19 NP_990849.1 Gallus gallus
GeneID:408256 actc1l NP_001001409.2 Danio rerio
GeneID:450133 ACTB NP_001009945.1 Pan troglodytes
GeneID:570210 zgc:86709 NP_001002066.1 Danio rerio
GeneID:610787 ACTB XP_536230.2 Canis lupus familiaris
GeneID:1268422 ENSANGG00000013909 XP_306981.2 Anopheles gambiae
GeneID:4352927 Os12g0641000 NP_001067399.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab37063 Actin antibody - Loading Control (ab37063); Rabbit polyclonal to Actin - Loading Control
2 abcam ab59340 Actin antibody (ab59340); Rabbit polyclonal to Actin
3 abcam ab54724 beta Actin antibody (ab54724); Mouse monoclonal to beta Actin
4 abcam ab52614 beta Actin antibody [EP1123Y] (ab52614); Rabbit monoclonal [EP1123Y] to beta Actin
5 abcam ab52220 Actin antibody (ab52220); Rabbit polyclonal to Actin
6 abcam ab49900 beta Actin antibody [AC-15] (HRP) (ab49900); Mouse monoclonal [AC-15] to beta Actin (HRP)
7 abcam ab49846 beta Actin antibody [AC-15] (ab49846); Mouse monoclonal [AC-15] to beta Actin
8 abcam ab40864 Actin antibody [C4] (ab40864); Mouse monoclonal [C4] to Actin
9 abcam ab37777 beta Actin antibody (ab37777); Chicken polyclonal to beta Actin
10 abcam ab8224 beta Actin antibody [mAbcam 8224] - Loading Control (ab8224); Mouse monoclonal [mAbcam 8224] to beta Actin - Loading Control
11 abcam ab20272 beta Actin antibody [mAbcam 8226] (HRP) - Loading Control (ab20272); Mouse monoclonal [mAbcam 8226] to beta Actin - Loading Control (HRP)
12 abcam ab8226 beta Actin antibody [mAbcam 8226] - Loading Control (ab8226); Mouse monoclonal [mAbcam 8226] to beta Actin - Loading Control
13 abcam ab6276 beta Actin antibody [AC-15] (ab6276); Mouse monoclonal [AC-15] to beta Actin
14 abcam ab75186 beta Actin antibody - Loading Control (ab75186); Rabbit polyclonal to beta Actin - Loading Control
15 abcam ab8227 beta Actin antibody - Loading Control (ab8227); Rabbit polyclonal to beta Actin - Loading Control
16 abcam ab6277 beta Actin antibody [AC-15] (FITC) (ab6277); Mouse monoclonal [AC-15] to beta Actin (FITC)
17 abcam ab13822 beta Actin antibody - Loading Control (ab13822); Chicken polyclonal to beta Actin - Loading Control
18 abcam ab14001 beta Actin antibody (ab14001); Chicken polyclonal to beta Actin
19 abcam ab16039 beta Actin antibody (ab16039); Rabbit polyclonal to beta Actin
20 abcam ab25894 beta Actin antibody (ab25894); Rabbit polyclonal to beta Actin
21 abcam ab8229 beta Actin antibody (ab8229); Goat polyclonal to beta Actin
22 abcam ab14130 Actin antibody (ab14130); Rabbit polyclonal to Actin
23 abcam ab11006 Actin antibody [KJ43A] (ab11006); Mouse monoclonal [KJ43A] to Actin
24 abcam ab17797 Actin antibody [SPM160] (ab17797); Mouse monoclonal [SPM160] to Actin
25 abcam ab3280 Actin antibody [ACTN05 (C4)] (ab3280); Mouse monoclonal [ACTN05 (C4)] to Actin
26 abcam ab17853 Actin antibody [SPM160], prediluted (ab17853); Mouse monoclonal [SPM160] to Actin, prediluted
27 abcam ab11003 Actin antibody [AC-40] (ab11003); Mouse monoclonal [AC-40] to Actin
28 abcam ab11004 Actin antibody [AC-40] (Cy3) (ab11004); Mouse monoclonal [AC-40] to Actin (Cy3)
29 abcam ab11005 Actin antibody [AC-40] (FITC) (ab11005); Mouse monoclonal [AC-40] to Actin (FITC)
30 abcam ab14129 Actin antibody [3G1] (ab14129); Mouse monoclonal [3G1] to Actin
31 abcam ab1801 Actin antibody (ab1801); Rabbit polyclonal to Actin
32 abcam ab17146 Actin antibody [1A4+5C5] (ab17146); Mouse monoclonal [1A4+5C5] to Actin
33 abcam ab18146 Actin antibody [3F10] (ab18146); Mouse monoclonal [3F10] to Actin
34 abcam ab70165 beta Actin antibody (ab70165); Rabbit polyclonal to beta Actin
35 abcam ab69512 Actin antibody (ab69512); Rabbit polyclonal to Actin
36 abcam ab66338 beta Actin antibody [4E8H3] (ab66338); Mouse monoclonal [4E8H3] to beta Actin
37 abcam ab64496 beta Actin antibody [mAbcam 8226] (FITC) (ab64496); Mouse monoclonal [mAbcam 8226] to beta Actin (FITC)
38 abcam ab59381 beta Actin (phospho Y55 + Y53) antibody (ab59381); Rabbit polyclonal to beta Actin (phospho Y55 + Y53)
39 abgent AP1491c ACTB/ACTC Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
40 abgent AP1491a ACTB/ACTC Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
41 abgent AM1021b Beta-actin Monoclonal Antibody; Purified Mouse Monoclonal Antibody (Mab)
42 abgent AM1021a Beta-actin Monoclonal Antibody (Ascites); Mouse Monoclonal Antibody (Mab)
43 abnova H00000060-M01 ACTB monoclonal antibody (M01), clone 3G4-F9; Mouse monoclonal antibody raised against a full length recombinant ACTB.
44 abnova H00000060-M03 ACTB monoclonal antibody (M03), clone 1E7; Mouse monoclonal antibody raised against a full-length recombinant ACTB.
45 acris AP15333PU-S Actin beta / ACTB; antibody Ab
46 acris AP08869PU-N Actin beta / ACTB; antibody Ab
47 acris AP00310PU-N Actin beta / ACTB; antibody Ab
48 acris AM08274PU-N Actin beta / ACTB (C-term); antibody Ab
49 acris AP07540PU-N Actin beta / ACTB; antibody Ab
50 acris AP00310CP-N Actin beta / ACTB Control peptide; antibody Ab/CP
51 acris AM00194PU-N Actin beta / ACTB (N-term); antibody Ab
52 acris AP09293PU-N Actin beta / ACTB (aa 359-368); antibody Ab
53 acris AP15333PU-N Actin beta / ACTB; antibody Ab
54 acris AP07129PU-N Actin beta / ACTB; antibody Ab
55 acris AM11016PU-N Actin beta / ACTB; antibody Ab
56 acris AP07457PU-N Actin beta / ACTB; antibody Ab
57 acris AM11015SU-N Actin beta / ACTB Ascites; antibody Ab
58 acris AP08996PU-N Actin beta / ACTB (N-term); antibody Ab
59 scbt ACTB ACTB Antibody / ACTB Antibodies;
60 sigma F3022 Monoclonal Anti-β-Actin–FITC antibody produced in mouse ;
61 sigma F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse ;
62 sigma A5441 Monoclonal Anti-β-Actin antibody produced in mouse ;
63 sigma A5316 Monoclonal Anti-β-Actin antibody produced in mouse ;
64 sigma A4700 Monoclonal Anti-Actin antibody produced in mouse ;
65 sigma C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse ;
66 sigma A3853 Monoclonal Anti-Actin antibody produced in mouse ;
67 sigma A3854 Monoclonal Anti-β-Actin−Peroxidase antibody produced in mouse ;
68 sigma A2103 Anti-Actin, N-terminal antibody produced in rabbit ;
69 sigma A1978 Monoclonal Anti-β-Actin antibody produced in mouse ;
70 sigma A2228 Monoclonal Anti-β-Actin antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACTB Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACTB Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030863 Component cortical cytoskeleton
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0035097 Component histone methyltransferase complex
GO:0035267 Component NuA4 histone acetyltransferase complex
GO:0005625 Component soluble fraction
GO:0005524 Function ATP binding
GO:0050998 Function nitric-oxide synthase binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0005200 Function structural constituent of cytoskeleton
GO:0006928 Process cell motion
GO:0007605 Process sensory perception of sound

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001101  UCSC Browser NP_001092 P60709   Q1KLZ0  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000331789 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000331789 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000331789 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000331789 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000331789 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000331789 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000331789 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000331789 MI0000253 hsa-miR-148a* AAAGUUCUGAGACACUCCGACU
ENST00000331789 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000331789 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000331789 MI0000234 hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG
ENST00000331789 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000331789 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000331789 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000331789 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000331789 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000331789 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000331789 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000331789 MI0000736 hsa-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENST00000331789 MI0000254 hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENST00000331789 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000331789 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000331789 MI0000805 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA
ENST00000331789 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000331789 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000331789 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000331789 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000331789 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000331789 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000331789 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000331789 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENST00000331789 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000331789 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000331789 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000331789 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENST00000331789 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000331789 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENST00000331789 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENST00000331789 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENST00000331789 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000331789 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK025375   AK058019   AK098751   AK130062   AK130157   AK222925   AK223032   AK223055   AK225414   AK301372   AK304552   AK308277   AK309997   AK316361   BC001301   BC002409   BC004251   BC008633   BC009636   BC012854   BC013380   BC013835   BC014401   BC014861   BC016045   BC023204   BC113036   CR589970   CR590046   CR590103   CR590210   CR590288   CR590411   CR590447   CR590683   CR590710   CR590978   CR591097   CR591224   CR591465   CR591660   CR591927   CR592262   CR592292   CR592305   CR592670   CR592795   CR593025   CR593072   CR593321   CR593592   CR593598   CR593734   CR593796   CR593813   CR593865   CR593896   CR593937   CR594038   CR594076   CR594099   CR594381   CR594884   CR594985   CR595182   CR595291   CR595306   CR595496   CR595695   CR595806   CR595832   CR596176   CR596290   CR596673   CR596787   CR597018   CR597103   CR597466   CR597659   CR598089   CR598272   CR598372   CR598425   CR598697   CR599179   CR599235   CR599455   CR599624   CR599635   CR599891   CR600186   CR600392   CR600532   CR600579   CR601026   CR601052   CR601086   CR601448   CR601524   CR601565   CR601870   CR602020   CR602174   CR602333   CR602339   CR602443   CR602445   CR602851   CR602874   CR602929   CR602945   CR603213   CR603387   CR603390   CR603726   CR604039   CR604921   CR605511   CR605646   CR605718   CR605790   CR605924   CR606116   CR606701   CR606861   CR607015   CR607619   CR607692   CR607921   CR607957   CR608132   CR608206   CR608226   CR608297   CR608353   CR608667   CR608988   CR609007   CR609017   CR609136   CR609188   CR609310   CR609542   CR610012   CR610041   CR611051   CR611285   CR611384   CR611429   CR611696   CR611749   CR611763   CR612057   CR612491   CR612788   CR612812   CR612952   CR612992   CR613219   CR613422   CR613471   CR613926   CR614505   CR614558   CR614609   CR614723   CR614901   CR615388   CR615653   CR616113   CR616143   CR616407   CR616607   CR616639   CR616679   CR616681   CR616694   CR616918   CR616937   CR616986   CR617137   CR617259   CR617334   CR617617   CR618716   CR618940   CR619592   CR619607   CR619615   CR619662   CR619957   CR619970   CR620171   CR620197   CR620246   CR620258   CR621112   CR621117   CR621183   CR621189   CR621402   CR621548   CR621625   CR621635   CR622089   CR622223   CR622502   CR622603   CR622634   CR622700   CR622834   CR623430   CR624202   CR624251   CR624284   CR624351   CR624852   CR625087   CR625492   CR625602   CR626030   DQ407611   DQ471327   DQ890960   DQ894128   EF036500   EF095209   K00790   M28424   NM_001101   V00478   X00351   X63432  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
103D5R
  • 103D5R does not affect the expression of ACTB protein
15695405
1-nitronaphthalene
  • 1-nitronaphthalene metabolite binds to ACTB protein
16453347
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in decreased expression of ACTB mRNA
12958071
Acetaminophen
  • Acetaminophen affects the expression of ACTB mRNA
17562736
Acrolein
  • Acrolein results in increased metabolism of ACTB protein
17570602
Allylamine
  • Allylamine results in increased expression of ACTB mRNA
15910882
Benzene
  • Benzene affects the expression of ACTB mRNA
15878777
benzyloxycarbonylleucyl-leucyl-leucine aldehyde
  • benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of ACTB mRNA
15857753
Calcitriol
  • [Calcium co-treated with Calcitriol] affects the expression of ACTB mRNA
15913539
Calcium
  • [Calcium co-treated with Calcitriol] affects the expression of ACTB mRNA
15913539
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACTB mRNA
  • Carbon Tetrachloride results in decreased expression of ACTB protein
18395095
chromium hexavalent ion
  • chromium hexavalent ion does not affect the expression of ACTB mRNA
12716893
cyanoginosin LR
  • cyanoginosin LR results in decreased expression of ACTB mRNA
17383702
Cyclophosphamide
  • Cyclophosphamide results in decreased expression of ACTB mRNA
12167460
Cyclophosphamide
  • Cyclophosphamide affects the expression of ACTB mRNA
10859244
Diethylhexyl Phthalate
  • Diethylhexyl Phthalate results in decreased expression of ACTB protein
16400681
Diethylstilbestrol
  • Diethylstilbestrol results in decreased expression of ACTB mRNA
15171707
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACTB mRNA
17215170
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACTB mRNA
17288598
furan
  • furan results in increased expression of ACTB mRNA
15120968
Hydrogen Peroxide
  • Hydrogen Peroxide results in decreased expression of ACTB mRNA
12419474
Ketone Bodies
  • Ketone Bodies results in increased expression of ACTB mRNA
16807920
Lipopolysaccharides
  • Lipopolysaccharides results in increased expression of ACTB mRNA
11779202
Methylnitrosourea
  • Methylnitrosourea results in increased mutagenesis of ACTB gene
10767621
Metribolone
  • Metribolone promotes the reaction [NDRG1 protein binds to ACTB protein]
17220478
Metribolone
  • Metribolone results in increased expression of ACTB protein
17152098
Mifepristone
  • Mifepristone results in decreased expression of ACTB mRNA
17584828
naphthalene
  • naphthalene metabolite binds to ACTB protein
16453347
naphthalene
  • naphthalene metabolite binds to ACTB protein
15892573
Nitroglycerin
  • Nitroglycerin results in decreased expression of ACTB mRNA
12102619
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of ACTB mRNA
17616710
Progesterone
  • Progesterone affects the expression of ACTB mRNA
17251523
resveratrol
  • resveratrol affects the expression of ACTB mRNA
15748624
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in decreased expression of ACTB mRNA
12419474
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ACTB mRNA
16054898
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in decreased expression of ACTB mRNA
15703262
Thioacetamide
  • Thioacetamide results in decreased expression of ACTB mRNA
  • Thioacetamide results in decreased expression of ACTB protein
18395095
Tretinoin
  • Tretinoin affects the expression of ACTB protein
15789344
Uranium
  • Uranium affects the expression of ACTB mRNA
  • Uranium affects the expression of ACTB protein
15672453
uranyl acetate
  • uranyl acetate affects the expression of ACTB mRNA
  • uranyl acetate affects the expression of ACTB protein
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 17107899, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 16140955, 16331271, 16788101, 16823087, 12679006, 15748426, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Liver Cirrhosis, Experimental inferred via Thioacetamide 16248980, 18295389, 16097051, 18395095
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 16490592, 17049120, 17164350, 17935668, 16267019
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 17125593, 16456233, 16317513, 17015251
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 15767336, 17804756, 17718901, 17636462
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 15827377, 16317513
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 16704527, 15264214, 15878914, 15547733, 16510608, 15547721, 15623463, 15150132
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Methemoglobinemia inferred via Nitroglycerin 3537620
Myocardial Infarction inferred via Nitroglycerin 14729435
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 17131329, 17020996, 11807958, 15313902, 12931682, 10767621, 10838139, 16944150, 16051031, 15113128, 11751437, 15688392, 16827153, 14999141
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 16257854, 15930296
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 17333356, 16105132, 11677210, 15861022, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16534752, 16002989, 16611131, 15751030
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 14681315, 16762066
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 15046698, 17136230
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Dermatitis, Atopic inferred via Diethylhexyl Phthalate 16882537
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 15136595, 15093573, 18234424, 11325840, 12006526, 16978400, 18323546
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 16413132, 17979934, 16651033, 16989017, 12388444, 10498854, 15643279, 12913760, 18483878, 18710439, 15276878, 18433785, 16614059, 17010015, 10700343, 18295254
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 15331540, 10990075
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 16376943, 15172196
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17658394, 17802794, 18172266, 17296974, 17008537
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829
Hepatitis, Toxic inferred via cyanoginosin LR 17654400
Lung Diseases inferred via chromium hexavalent ion 16775837
Lung Neoplasms inferred via chromium hexavalent ion 16570259, 16876463
Nose Neoplasms inferred via chromium hexavalent ion 16876463
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 15700767, 16124888, 16227642, 10355542, 16011737, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16248980, 17525996, 17557913, 18156304, 16638106, 18418968, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 12666154, 18395095, 17976157, 17805973, 15925388, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Osteoporosis inferred via Calcium 17882678
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Anemia, Aplastic inferred via Benzene 14761424, 17661222, 11369114
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 14694614, 18335105, 17119257
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 17119257, 16737584, 15576619, 15913788, 15612468, 17178637, 15935809, 15727169
Thymus Neoplasms inferred via Benzene 10850423
Alzheimer Disease inferred via Acrolein 14715435, 17570602, 15207723
Arteriosclerosis inferred via Acrolein 15014928
Atherosclerosis inferred via Acrolein 17363696, 16037261, 16126721
Colorectal Neoplasms inferred via Acrolein 17597105
Kidney Diseases inferred via Acrolein 12488133
Kidney Failure inferred via Acrolein 12732208
Lung Diseases inferred via Acrolein 11504702
Melanoma, Experimental inferred via Acrolein 10803710
Neoplasms inferred via Acrolein 17329238
Nephritis inferred via Acrolein 12653641
Neurodegenerative Diseases inferred via Acrolein 11342003
Parkinson Disease inferred via Acrolein 17690948
Photosensitivity Disorders inferred via Acrolein 11550810
Stroke inferred via Acrolein 16269634
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACTB ACTB / ACTB Affinity Capture-Western Rual JF (2005)
ACTB ACTB / ACTB Reconstituted Complex Shartava A (1997)
ACTB ACTB / ACTB Two-hybrid Rual JF (2005)
ACTG1 ACTB / ACTG1 Two-hybrid Rual JF (2005)
CCT2 ACTB / CCT2 Co-crystal Structure McCormack EA (2001)
Cct3 ACTB / Cct3 Reconstituted Complex Hynes GM (2000)
Cct4 ACTB / Cct4 Reconstituted Complex Hynes GM (2000)
Cct5 ACTB / Cct5 Reconstituted Complex Hynes GM (2000)
CCT5 ACTB / CCT5 Co-crystal Structure McCormack EA (2001)
Cct6a ACTB / Cct6a Reconstituted Complex Hynes GM (2000)
Cct7 ACTB / Cct7 Reconstituted Complex Hynes GM (2000)
Cct8 ACTB / Cct8 Reconstituted Complex Hynes GM (2000)
CFL1 ACTB / CFL1 Two-hybrid Rual JF (2005)
CFL2 ACTB / CFL2 Affinity Capture-Western Rual JF (2005)
CFL2 ACTB / CFL2 Two-hybrid Rual JF (2005)
DSTN ACTB / DSTN Two-hybrid Rual JF (2005)
Hspa1b ACTB / Hspa1b Reconstituted Complex Hynes GM (2000)
MYC MYC / ACTB Co-purification Park J (2002)
NCALD ACTB / NCALD Affinity Capture-Western Rual JF (2005)
NCF1 ACTB / NCF1 Far Western Tamura M (2000)
NCF2 ACTB / NCF2 Far Western Tamura M (2000)
P2rx7 P2rx7 / ACTB Affinity Capture-MS Kim M (2001)
P2rx7 P2rx7 / ACTB Affinity Capture-Western Kim M (2001)
Pcyt1a ACTB / Pcyt1a Reconstituted Complex Hynes GM (2000)
Pcyt1b ACTB / Pcyt1b Reconstituted Complex Hynes GM (2000)
PCYT1B ACTB / PCYT1B Co-crystal Structure McCormack EA (2001)
PFN1 PFN1 / ACTB Co-crystal Structure Nodelman IM (1999)
PFN1 PFN1 / ACTB Reconstituted Complex Nunoi H (1999)
RAB8B RAB8B / ACTB Affinity Capture-Western Lau AS (2003)
RAC1 ACTB / RAC1 Far Western Tamura M (2000)
RAC2 ACTB / RAC2 Far Western Tamura M (2000)
SMARCA4 SMARCA4 / ACTB Affinity Capture-Western Zhao K (1998)
SMARCC2 SMARCC2 / ACTB Affinity Capture-Western Zhao K (1998)
SMARCE1 SMARCE1 / ACTB Affinity Capture-Western Zhao K (1998)
SPTBN2 SPTBN2 / ACTB Reconstituted Complex Mao B (2001)
SSH1 ACTB / SSH1 Reconstituted Complex Niwa R (2002)
SSH2 ACTB / SSH2 Reconstituted Complex Niwa R (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Fujiki R, et al. (2009) "GlcNAcylation of a histone methyltransferase in retinoic-acid-induced granulopoiesis." Nature. 459(7245):455-459. PMID:19377461
  2. [ + ] Dassa EP, et al. (2008) "The mtDNA NARP mutation activates the actin-Nrf2 signaling of antioxidant defenses." Biochem Biophys Res Commun. 368(3):620-624. PMID:18261463
  3. [ + ] Rinne T, et al. (2008) "A novel translation re-initiation mechanism for the p63 gene revealed by amino-terminal truncating mutations in Rapp-Hodgkin/Hay-Wells-like syndromes." Hum Mol Genet. 17(13):1968-1977. PMID:18364388
  4. [ + ] Kawashima H, et al. (2008) "mRNA expression of T-helper 1, T-helper 2 cytokines in autoimmune hepatitis in childhood." Pediatr Int. 50(3):284-286. PMID:18533937
  5. [ + ] Tsvetkov AS, et al. (2007) "Microtubule-binding proteins CLASP1 and CLASP2 interact with actin filaments." Cell Motil Cytoskeleton. 64(7):519-530. PMID:17342765
  6. [ + ] Ji Y, et al. (2007) "beta-Actin regulates platelet nitric oxide synthase 3 activity through interaction with heat shock protein 90." Proc Natl Acad Sci U S A. 104(21):8839-8844. PMID:17502619
  7. [ + ] Villebeck L, et al. (2007) "Domain-specific chaperone-induced expansion is required for beta-actin folding: a comparison of beta-actin conformations upon interactions with GroEL and tail-less complex polypeptide 1 ring complex (TRiC)." Biochemistry. 46(44):12639-12647. PMID:17939680
  8. [ + ] Cury PR, et al. (2007) "The effect of epidermal growth factor on matrix metalloproteinases and tissue inhibitors of metalloproteinase gene expression in cultured human gingival fibroblasts." Arch Oral Biol. 52(6):585-590. PMID:17181997
  9. [ + ] Dormoy-Raclet V, et al. (2007) "The RNA-binding protein HuR promotes cell migration and cell invasion by stabilizing the beta-actin mRNA in a U-rich-element-dependent manner." Mol Cell Biol. 27(15):5365-5380. PMID:17548472
  10. [ + ] Frum R, et al. (2007) "HDM2-binding partners: interaction with translation elongation factor EF1alpha." J Proteome Res. 6(4):1410-1417. PMID:17373842
  11. [ + ] Avizienyte E, et al. (2007) "An active Src kinase-beta-actin association is linked to actin dynamics at the periphery of colon cancer cells." Exp Cell Res. 313(15):3175-3188. PMID:17651734
  12. [ + ] Chang KW, et al. (2006) "Identification of a novel actin isoform in hepatocellular carcinoma." Hepatol Res. 36(1):33-39. PMID:16824795
  13. [ + ] Pappenberger G, et al. (2006) "Quantitative actin folding reactions using yeast CCT purified via an internal tag in the CCT3/gamma subunit." J Mol Biol. 360(2):484-496. PMID:16762366
  14. [ + ] Procaccio V, et al. (2006) "A mutation of beta -actin that alters depolymerization dynamics is associated with autosomal dominant developmental malformations, deafness, and dystonia." Am J Hum Genet. 78(6):947-960. PMID:16685646
  15. [ + ] Urata Y, et al. (2006) "17Beta-estradiol protects against oxidative stress-induced cell death through the glutathione/glutaredoxin-dependent redox regulation of Akt in myocardiac H9c2 cells." J Biol Chem. 281(19):13092-13102. PMID:16549430
  16. [ + ] Tamura M, et al. (2006) "Identification of an actin-binding site in p47phox an organizer protein of NADPH oxidase." FEBS Lett. 580(1):261-267. PMID:16375898
  17. [ + ] Coiras M, et al. (2006) "Modifications in the human T cell proteome induced by intracellular HIV-1 Tat protein expression." Proteomics. 6 Suppl 1():S63-S73. PMID:16526095
  18. [ + ] Tang HL, et al. (2006) "The increase in mitochondrial association with actin precedes Bax translocation in apoptosis." Biochem J. 396(1):1-5. PMID:16536728
  19. [ + ] Fautsch MP, et al. (2006) "The identification of myocilin-associated proteins in the human trabecular meshwork." Exp Eye Res. 82(6):1046-1052. PMID:16289162
  20. [ + ] Xu B, et al. (2005) "Increased expression in dorsolateral prefrontal cortex of CAPON in schizophrenia and bipolar disorder." PLoS Med. 2(10):e263. PMID:16146415
  21. [ + ] Pederson T, et al. (2005) "Nuclear actin extends, with no contraction in sight." Mol Biol Cell. 16(11):5055-5060. PMID:16148048
  22. [ + ] Pope SN, et al. (2005) "Yeast two-hybrid identification of prostatic proteins interacting with human sex hormone-binding globulin." J Steroid Biochem Mol Biol. 94(1-3):203-208. PMID:15862967
  23. [ + ] Varga AE, et al. (2005) "Silencing of the Tropomyosin-1 gene by DNA methylation alters tumor suppressor function of TGF-beta." Oncogene. 24(32):5043-5052. PMID:15897890
  24. [ + ] Ahmed M, et al. (2005) "Protein profiling of human pancreatic islets by two-dimensional gel electrophoresis and mass spectrometry." J Proteome Res. 4(3):931-940. PMID:15952740
  25. [ + ] Wang L, et al. (2005) "A two-dimensional electrophoresis reference map of human ovary." J Mol Med. 83(10):812-821. PMID:16021519
  26. [ + ] Suzuki T, et al. (2005) "A novel scaffold protein, TANC, possibly a rat homolog of Drosophila rolling pebbles (rols), forms a multiprotein complex with various postsynaptic density proteins." Eur J Neurosci. 21(2):339-350. PMID:15673434
  27. [ + ] Pocernich CB, et al. (2005) "Proteomic analysis of oxidatively modified proteins induced by the mitochondrial toxin 3-nitropropionic acid in human astrocytes expressing the HIV protein tat." Brain Res Mol Brain Res. 133(2):299-306. PMID:15710247
  28. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  29. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  30. [ + ] Bruneel A, et al. (2005) "Proteomics of human umbilical vein endothelial cells applied to etoposide-induced apoptosis." Proteomics. 5(15):3876-3884. PMID:16130169
  31. [ + ] Kukalev A, et al. (2005) "Actin and hnRNP U cooperate for productive transcription by RNA polymerase II." Nat Struct Mol Biol. 12(3):238-244. PMID:15711563
  32. [ + ] Ou H, et al. (2005) "Effect of nuclear actin on endothelial nitric oxide synthase expression." Arterioscler Thromb Vasc Biol. 25(12):2509-2514. PMID:16210567
  33. [ + ] Szymkiewicz I, et al. (2004) "SH3P2 in complex with Cbl and Src." FEBS Lett. 565(1-3):33-38. PMID:15135048
  34. [ + ] Campbell EM, et al. (2004) "Disruption of the actin cytoskeleton can complement the ability of Nef to enhance human immunodeficiency virus type 1 infectivity." J Virol. 78(11):5745-5755. PMID:15140972
  35. [ + ] Lin MF, et al. (2004) "Human cytomegalovirus induces alteration of beta-actin mRNA and microfilaments in human embryo fibroblast cells." J Zhejiang Univ Sci. 5(6):733-737. PMID:15101111
  36. [ + ] Anderson JL, et al. (2004) "HIV accessory proteins and surviving the host cell." Curr HIV/AIDS Rep. 1(1):47-53. PMID:16091223
  37. [ + ] Dahlen A, et al. (2004) "Activation of the GLI oncogene through fusion with the beta-actin gene (ACTB) in a group of distinctive pericytic neoplasms: pericytoma with t(7;12)." Am J Pathol. 164(5):1645-1653. PMID:15111311
  38. [ + ] Than NG, et al. (2004) "Functional analyses of placental protein 13/galectin-13." Eur J Biochem. 271(6):1065-1078. PMID:15009185
  39. [ + ] Colland F, et al. (2004) "Functional proteomics mapping of a human signaling pathway." Genome Res. 14(7):1324-1332. PMID:15231748
  40. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  41. [ + ] Navarro-Lerida I, et al. (2004) "Proteomic identification of brain proteins that interact with dynein light chain LC8." Proteomics. 4(2):339-346. PMID:14760703
  42. [ + ] Doyon Y, et al. (2004) "Structural and functional conservation of the NuA4 histone acetyltransferase complex from yeast to humans." Mol Cell Biol. 24(5):1884-1896. PMID:14966270
  43. [ + ] Hu P, et al. (2004) "A role for beta-actin in RNA polymerase III transcription." Genes Dev. 18(24):3010-3015. PMID:15574586
  44. [ + ] Grimsby S, et al. (2004) "Proteomics-based identification of proteins interacting with Smad3: SREBP-2 forms a complex with Smad3 and inhibits its transcriptional activity." FEBS Lett. 577(1-2):93-100. PMID:15527767
  45. [ + ] Simons CT, et al. (2004) "Selective contribution of eukaryotic prefoldin subunits to actin and tubulin binding." J Biol Chem. 279(6):4196-4203. PMID:14634002
  46. [ + ] Wu RF, et al. (2004) "Human immunodeficiency virus type 1 Tat regulates endothelial cell actin cytoskeletal dynamics through PAK1 activation and oxidant production." J Virol. 78(2):779-789. PMID:14694110
  47. [ + ] Dahlen A, et al. (2004) "Molecular genetic characterization of the genomic ACTB-GLI fusion in pericytoma with t(7;12)." Biochem Biophys Res Commun. 325(4):1318-1323. PMID:15555571
  48. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  49. [ + ] Hofmann WA, et al. (2004) "Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II." Nat Cell Biol. 6(11):1094-1101. PMID:15502823
  50. [ + ] Johansson T, et al. (2004) "Detection of binding partners to the profilin:actin complex by far Western and mass spectrometry analyses." Anal Biochem. 335(2):228-234. PMID:15556561