0610007P14Rik | GeneID:58520 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 58520 Official Symbol 0610007P14Rik
Locus N/A Gene Type protein-coding
Synonyms 1190004E09Rik; AU019315; C77855; ORF11
Full Name RIKEN cDNA 0610007P14 gene
Description RIKEN cDNA 0610007P14 gene
Chromosome 12 D2
Also Known As c14orf1-like protein; hypothetical protein LOC58520
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38284

ID Symbol Protein Species
GeneID:11161 C14orf1 NP_009107.1 Homo sapiens
GeneID:58520 0610007P14Rik NP_067421.1 Mus musculus
GeneID:299207 RGD1310769 XP_216756.3 Rattus norvegicus
GeneID:453051 LOC453051 XP_510078.2 Pan troglodytes
GeneID:539248 C10H14ORF1 NP_001030500.1 Bos taurus
GeneID:565132 LOC565132 XP_693522.1 Danio rerio
GeneID:611962 LOC611962 XP_854777.1 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab56063 ERG28 antibody (ab56063); Mouse polyclonal to ERG28

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0008610 Process lipid biosynthetic process
GO:0006694 Process steroid biosynthetic process
GO:0016126 Process sterol biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_021446  UCSC Browser NP_067421

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000021676 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSMUST00000021676 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSMUST00000021676 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSMUST00000021676 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSMUST00000021676 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSMUST00000021676 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSMUST00000021676 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSMUST00000021676 MI0000585 mmu-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSMUST00000021676 MI0000170 mmu-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSMUST00000021676 MI0000246 mmu-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSMUST00000021676 MI0000248 mmu-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSMUST00000021676 MI0000249 mmu-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSMUST00000021676 MI0000698 mmu-miR-214* UGCCUGUCUACACUUGCUGUGC
ENSMUST00000021676 MI0005487 mmu-miR-220 CCACCACAGUGUCAGACACUU
ENSMUST00000021676 MI0000578 mmu-miR-27a UUCACAGUGGCUAAGUUCCGC
ENSMUST00000021676 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000021676 MI0000690 mmu-miR-28 AAGGAGCUCACAGUCUAUUGAG
ENSMUST00000021676 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000021676 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSMUST00000021676 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSMUST00000021676 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSMUST00000021676 MI0004671 mmu-miR-467b* AUAUACAUACACACACCAACAC
ENSMUST00000021676 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSMUST00000021676 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSMUST00000021676 MI0000728 mmu-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSMUST00000021676 MI0000729 mmu-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSMUST00000021676 MI0000730 mmu-miR-7b UGGAAGACUUGUGAUUUUGUUGU
ENSMUST00000021676 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSMUST00000021676 MI0005551 mmu-miR-875-3p CCUGAAAAUACUGAGGCUAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Easterday MC, et al. (2003) "Neural progenitor genes. Germinal zone expression and analysis of genetic overlap in stem cell populations." Dev Biol. 264(2):309-322. PMID:14651920
  5. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  8. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  9. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  10. [ + ] Ottolenghi C, et al. (2000) "The genomic structure of c14orf1 is conserved across eukarya." Mamm Genome. 11(9):786-788. PMID:10967139
  11. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  12. [ + ] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249
  13. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636