EPS15L1 | GeneID:58513 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 58513 Official Symbol EPS15L1
Locus N/A Gene Type protein-coding
Synonyms EPS15R
Full Name epidermal growth factor receptor pathway substrate 15-like 1
Description epidermal growth factor receptor pathway substrate 15-like 1
Chromosome 19p13.11
Also Known As epidermal growth factor receptor substrate EPS15R
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31881

ID Symbol Protein Species
GeneID:13859 Eps15l1 NP_031970.1 Mus musculus
GeneID:37961 Eps-15 NP_611965.2 Drosophila melanogaster
GeneID:58513 EPS15L1 NP_067058.1 Homo sapiens
GeneID:173985 ehs-1 NP_001022499.1 Caenorhabditis elegans
GeneID:361120 Eps15l1 NP_001025092.1 Rattus norvegicus
GeneID:420147 EPS15L1 XP_418263.2 Gallus gallus
GeneID:484849 EPS15L1 XP_541965.2 Canis lupus familiaris
GeneID:506374 EPS15L1 XP_869048.2 Bos taurus
GeneID:568170 si:dkeyp-192m14.7 XP_696575.3 Danio rerio
GeneID:1280150 AgaP_AGAP009189 XP_319960.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71728 EPS15L1 antibody - Aminoterminal end (ab71728); Rabbit polyclonal to EPS15L1 - Aminoterminal end
2 abcam ab53006 EPS15R antibody [EP1145Y] (ab53006); Rabbit monoclonal [EP1145Y] to EPS15R
3 abcam ab72727 EPS15R antibody (ab72727); Rabbit polyclonal to EPS15R
4 abcam ab71727 EPS15L1 antibody - Carboxyterminal end (ab71727); Rabbit polyclonal to EPS15L1 - Carboxyterminal end
5 abgent AP2160a EPS15R Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP2160b EPS15R Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
7 acris AP12063PU-N EPS15L1 / EPS15R (N-term); antibody Ab
8 acris AP12064PU-N EPS15L1 / EPS15R (C-term); antibody Ab
9 scbt EPS15L1 EPS15L1 Antibody / EPS15L1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of EPS15L1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EPS15L1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005905 Component coated pit
GO:0005634 Component nucleus
GO:0005886 Component plasma membrane
GO:0005509 Function calcium ion binding
GO:0005515 Function protein binding
GO:0006897 Process endocytosis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_021235  UCSC Browser NP_067058

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000248070 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000248070 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENST00000248070 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000248070 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000248070 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000248070 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000248070 MI0000082 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG
ENST00000248070 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000248070 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000248070 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000248070 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000248070 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000248070 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000248070 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000248070 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000248070 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000248070 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000248070 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000248070 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000248070 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000248070 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000248070 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000248070 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENST00000248070 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENST00000248070 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000248070 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000248070 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000248070 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000248070 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of EPS15L1 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
EPN1 EPN1 / EPS15L1 Affinity Capture-Western Chen H (1998)
HRB EPS15L1 / HRB Phenotypic Enhancement Doria M (1999)
HRB EPS15L1 / HRB Two-hybrid Doria M (1999)
STN2 STN2 / EPS15L1 Two-hybrid Martina JA (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Schmid EM, et al. (2006) "Role of the AP2 beta-appendage hub in recruiting partners for clathrin-coated vesicle assembly." PLoS Biol. 4(9):e262. PMID:16903783
  2. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  3. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  4. [ + ] Haglund K, et al. (2005) "Sprouty2 acts at the Cbl/CIN85 interface to inhibit epidermal growth factor receptor downregulation." EMBO Rep. 6(7):635-641. PMID:15962011
  5. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  6. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  7. [ + ] Brill LM, et al. (2004) "Robust phosphoproteomic profiling of tyrosine phosphorylation sites from human T cells using immobilized metal affinity chromatography and tandem mass spectrometry." Anal Chem. 76(10):2763-2772. PMID:15144186
  8. [ + ] Poupon V, et al. (2002) "Differential nucleocytoplasmic trafficking between the related endocytic proteins Eps15 and Eps15R." J Biol Chem. 277(11):8941-8948. PMID:11777906
  9. [ + ] Haglund K, et al. (2002) "Cbl-directed monoubiquitination of CIN85 is involved in regulation of ligand-induced degradation of EGF receptors." Proc Natl Acad Sci U S A. 99(19):12191-12196. PMID:12218189
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Martina JA, et al. (2001) "Stonin 2: an adaptor-like protein that interacts with components of the endocytic machinery." J Cell Biol. 153(5):1111-1120. PMID:11381094
  12. [ + ] Offenhauser N, et al. (2000) "Differential patterns of expression of Eps15 and Eps15R during mouse embryogenesis." Mech Dev. 95(1-2):309-312. PMID:10906484
  13. [ + ] Rosenthal JA, et al. (1999) "The epsins define a family of proteins that interact with components of the clathrin coat and contain a new protein module." J Biol Chem. 274(48):33959-33965. PMID:10567358
  14. [ + ] Doria M, et al. (1999) "The eps15 homology (EH) domain-based interaction between eps15 and hrb connects the molecular machinery of endocytosis to that of nucleocytosolic transport." J Cell Biol. 147(7):1379-1384. PMID:10613896
  15. [ + ] Coda L, et al. (1998) "Eps15R is a tyrosine kinase substrate with characteristics of a docking protein possibly involved in coated pits-mediated internalization." J Biol Chem. 273(5):3003-3012. PMID:9446614
  16. [ + ] Ueki N, et al. (1998) "Selection system for genes encoding nuclear-targeted proteins." Nat Biotechnol. 16(13):1338-1342. PMID:9853615
  17. [ + ] Chen H, et al. (1998) "Epsin is an EH-domain-binding protein implicated in clathrin-mediated endocytosis." Nature. 394(6695):793-797. PMID:9723620
  18. [ + ] Carbone R, et al. (1997) "eps15 and eps15R are essential components of the endocytic pathway." Cancer Res. 57(24):5498-5504. PMID:9407958
  19. [ + ] Salcini AE, et al. (1997) "Binding specificity and in vivo targets of the EH domain, a novel protein-protein interaction module." Genes Dev. 11(17):2239-2249. PMID:9303539