ABCD4 | GeneID:5826 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5826 Official Symbol ABCD4
Locus N/A Gene Type protein-coding
Synonyms ABC41; EST352188; P70R; P79R; PMP69; PXMP1L
Full Name ATP-binding cassette, sub-family D (ALD), member 4
Description ATP-binding cassette, sub-family D (ALD), member 4
Chromosome 14q24.3
Also Known As 69 kDa peroxisomal ABC-transporter; ATP-binding cassette, sub-family D, member 4; peroxisomal membrane protein 1-like; peroxisomal membrane protein 69
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that it may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. Alternative splicing results in at least two different transcript variants, one which is protein-coding and one which is probably not protein-coding. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3703

ID Symbol Protein Species
GeneID:5826 ABCD4 NP_005041.1 Homo sapiens
GeneID:19300 Abcd4 NP_033018.1 Mus musculus
GeneID:179968 pmp-3 NP_506620.1 Caenorhabditis elegans
GeneID:299196 Abcd4 XP_001061210.1 Rattus norvegicus
GeneID:423349 ABCD4 XP_421264.2 Gallus gallus
GeneID:453032 ABCD4 XP_001156286.1 Pan troglodytes
GeneID:490781 ABCD4 XP_547903.2 Canis lupus familiaris
GeneID:767748 zgc:153503 NP_001070185.1 Danio rerio
GeneID:841876 AT1G54350 NP_175837.2 Arabidopsis thaliana
GeneID:4324587 Os01g0218700 NP_001042413.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab60133 ABCD4 antibody (ab60133); Rabbit polyclonal to ABCD4
2 acris AP16970PU-N ABCD4 / PXMP1L; antibody Ab
3 scbt ABCD4 ABCD4 Antibody / ABCD4 Antibodies;
4 sigma HPA003396 Anti-ABCD4 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCD4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCD4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0005737 Component cytoplasm
GO:0016021 Component integral to membrane
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005050  UCSC Browser NP_005041
2 NR_003256  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000356924 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000356924 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000356924 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000356924 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000356924 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000356924 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000356924 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000356924 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000356924 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000356924 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000356924 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000356924 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000356924 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000356924 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000356924 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENST00000356924 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000356924 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
DLEU1 DLEU1 / ABCD4 Two-hybrid Stelzl U (2005)
PEA15 ABCD4 / PEA15 Two-hybrid Stelzl U (2005)
XRCC6 ABCD4 / XRCC6 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  4. [ + ] Kuiper H, et al. (2005) "Physical mapping of CHX10, ALDH6A1, and ABCD4 on bovine chromosome 10q34." Cytogenet Genome Res. 109(4):533. PMID:15909363
  5. [ + ] Asheuer M, et al. (2005) "Decreased expression of ABCD4 and BG1 genes early in the pathogenesis of X-linked adrenoleukodystrophy." Hum Mol Genet. 14(10):1293-1303. PMID:15800013
  6. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Iida A, et al. (2002) "Catalog of 605 single-nucleotide polymorphisms (SNPs) among 13 genes encoding human ATP-binding cassette transporters: ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8." J Hum Genet. 47(6):285-310. PMID:12111378
  9. [ + ] Holzinger A, et al. (1998) "Genomic organization and chromosomal localization of the human peroxisomal membrane protein-1-like protein (PXMP1-L) gene encoding a peroxisomal ABC transporter." FEBS Lett. 426(2):238-242. PMID:9599016
  10. [ + ] Gartner J, et al. (1998) "Genomic organization of the 70-kDa peroxisomal membrane protein gene (PXMP1)." Genomics. 48(2):203-208. PMID:9521874
  11. [ + ] Shani N, et al. (1997) "Identification of a fourth half ABC transporter in the human peroxisomal membrane." Hum Mol Genet. 6(11):1925-1931. PMID:9302272
  12. [ + ] Holzinger A, et al. (1997) "Primary structure of human PMP69, a putative peroxisomal ABC-transporter." Biochem Biophys Res Commun. 237(1):152-157. PMID:9266848
  13. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548