ABCD3 | GeneID:5825 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5825 Official Symbol ABCD3
Locus N/A Gene Type protein-coding
Synonyms ABC43; PMP70; PXMP1
Full Name ATP-binding cassette, sub-family D (ALD), member 3
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome 1p22-p21
Also Known As ATP-binding cassette, sub-family D, member 3; OTTHUMP00000012428; Peroxisomal membrane protein-1 (70kD); dJ824O18.1 (ATP-binding cassette, sub-family D (ALD), member 3 (PMP70, PXMP1)); peroxisomal membrane protein 1 (70kD, Zellweger syndrome)
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3421 PMP70 antibody - Peroxisomal Membrane Marker (ab3421); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker
2 abcam ab28499 PMP70 antibody (Biotin) (ab28499); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker (Biotin)
3 abnova H00005825-M04 ABCD3 monoclonal antibody (M04), clone 2H6; Mouse monoclonal antibody raised against a partial recombinant ABCD3.
4 acris AP16810PU-N ABCD3 / PMP70; antibody Ab
5 scbt ABCD3 ABCD3 Antibody / ABCD3 Antibodies;
6 sigma P0497 Anti-PMP70 antibody produced in rabbit ;
7 sigma P0090 Anti-PMP70−Atto 488 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCD3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCD3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005779 Component integral to peroxisomal membrane
GO:0016020 Component membrane
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0015910 Process peroxisomal long-chain fatty acid import
GO:0007031 Process peroxisome organization
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001122674  UCSC Browser NP_001116146
2 NM_002858  UCSC Browser NP_002849

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000315713 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000315713 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000315713 MI0000471 hsa-miR-126* CAUUAUUACUUUUGGUACGCG
ENST00000315713 MI0000461 hsa-miR-145* GGAUUCCUGGAAAUACUGUUCU
ENST00000315713 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000315713 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENST00000315713 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000315713 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000315713 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000315713 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000315713 MI0000802 hsa-miR-340* UCCGUCUCAGUUACUUUAUAGC
ENST00000315713 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000315713 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000315713 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000315713 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000315713 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000315713 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000315713 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000315713 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000315713 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000315713 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000315713 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000315713 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000315713 MI0003150 hsa-miR-526b* GAAAGUGCUUCCUUUUAGAGGC
ENST00000315713 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000315713 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000315713 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000315713 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000315713 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000315713 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000315713 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000315713 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000315713 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000315713 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENST00000315713 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000315713 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENST00000370214 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000370214 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000370214 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000370214 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000370214 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000370214 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000370214 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000370214 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000370214 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000370214 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000370214 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000370214 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000370214 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000370214 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000370214 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2,4-Dichlorophenoxyacetic Acid
  • 2,4-Dichlorophenoxyacetic Acid results in increased expression of ABCD3 protein
11460719
Acetaminophen
  • Acetaminophen affects the expression of ABCD3 mRNA
17562736
alitretinoin
  • alitretinoin results in increased expression of ABCD3 mRNA
16648578
bexarotene
  • bexarotene results in increased expression of ABCD3 mRNA
16648578
Estradiol
  • Estradiol affects the expression of ABCD3 mRNA
14699072
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ABCD3 mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ABCD3 mRNA
18301758, 17426115, 15375163
Tamoxifen
  • Tamoxifen results in decreased expression of ABCD3 mRNA
17555576
Tetracycline
  • Tetracycline results in increased expression of ABCD3 mRNA
16917069

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Zellweger Syndrome marker
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 15565566, 11161223, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 16818667
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 14630087, 17261762, 18497071, 17018787
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 16891317, 11408345, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Agricultural Workers' Diseases inferred via 2,4-Dichlorophenoxyacetic Acid 16132792
Infertility, Male inferred via 2,4-Dichlorophenoxyacetic Acid 12948887
Lymphoma, Non-Hodgkin inferred via 2,4-Dichlorophenoxyacetic Acid 16132792

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCD1 ABCD3 / ABCD1 Two-hybrid Liu LX (1999)
BRF2 BRF2 / ABCD3 Affinity Capture-MS Ewing RM (2007)
C20orf24 C20orf24 / ABCD3 Affinity Capture-MS Ewing RM (2007)
MEST MEST / ABCD3 Affinity Capture-MS Ewing RM (2007)
MLF2 MLF2 / ABCD3 Affinity Capture-MS Ewing RM (2007)
PELO PELO / ABCD3 Affinity Capture-MS Ewing RM (2007)
PEX19 ABCD3 / PEX19 Reconstituted Complex Biermanns M (2001)
PEX19 PEX19 / ABCD3 Reconstituted Complex Gloeckner CJ (2000)
PEX19 PEX19 / ABCD3 Reconstituted Complex Mayerhofer PU (2002)
PEX19 PEX19 / ABCD3 Reconstituted Complex Sacksteder KA (2000)
PEX19 PEX19 / ABCD3 Two-hybrid Gloeckner CJ (2000)
PGRMC1 PGRMC1 / ABCD3 Affinity Capture-MS Ewing RM (2007)
PTP4A3 PTP4A3 / ABCD3 Affinity Capture-MS Ewing RM (2007)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  3. [ + ] Petroni A, et al. (2007) "Effect of testosterone metabolites on ABC half-transporter relative gene expression in X-linked adrenoleukodystrophy." J Inherit Metab Dis. 30(5):828. PMID:17602313
  4. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  5. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414
  6. [ + ] Kashiwayama Y, et al. (2005) "Role of Pex19p in the targeting of PMP70 to peroxisome." Biochim Biophys Acta. 1746(2):116-128. PMID:16344115
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Tanaka AR, et al. (2002) "ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1)." J Biol Chem. 277(42):40142-40147. PMID:12176987
  10. [ + ] Mayerhofer PU, et al. (2002) "Two splice variants of human PEX19 exhibit distinct functions in peroxisomal assembly." Biochem Biophys Res Commun. 291(5):1180-1186. PMID:11883941
  11. [ + ] Biermanns M, et al. (2001) "Targeting elements in the amino-terminal part direct the human 70-kDa peroxisomal integral membrane protein (PMP70) to peroxisomes." Biochem Biophys Res Commun. 285(3):649-655. PMID:11453642
  12. [ + ] Roerig P, et al. (2001) "Characterization and functional analysis of the nucleotide binding fold in human peroxisomal ATP binding cassette transporters." FEBS Lett. 492(1-2):66-72. PMID:11248239
  13. [ + ] Gloeckner CJ, et al. (2000) "Human adrenoleukodystrophy protein and related peroxisomal ABC transporters interact with the peroxisomal assembly protein PEX19p." Biochem Biophys Res Commun. 271(1):144-150. PMID:10777694
  14. [ + ] Sacksteder KA, et al. (2000) "PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis." J Cell Biol. 148(5):931-944. PMID:10704444
  15. [ + ] Liu LX, et al. (1999) "Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters." J Biol Chem. 274(46):32738-32743. PMID:10551832
  16. [ + ] Collins CS, et al. (1999) "Identification of a common PEX1 mutation in Zellweger syndrome." Hum Mutat. 14(1):45-53. PMID:10447258
  17. [ + ] Gartner J, et al. (1998) "Genomic organization of the 70-kDa peroxisomal membrane protein gene (PXMP1)." Genomics. 48(2):203-208. PMID:9521874
  18. [ + ] Paton BC, et al. (1997) "Absence of mutations raises doubts about the role of the 70-kD peroxisomal membrane protein in Zellweger syndrome." Am J Hum Genet. 60(6):1535-1539. PMID:9199576
  19. [ + ] Kobayashi T, et al. (1997) "Adrenoleukodystrophy protein-deficient mice represent abnormality of very long chain fatty acid metabolism." Biochem Biophys Res Commun. 232(3):631-636. PMID:9126326
  20. [ + ] Shimozawa N, et al. (1996) "Correction by gene expression of biochemical abnormalities in fibroblasts from Zellweger patients." Pediatr Res. 39(5):812-815. PMID:8726233
  21. [ + ] Gartner J, et al. (1993) "The 70 kDa peroxisomal membrane protein: an ATP-binding cassette transporter protein involved in peroxisome biogenesis." Semin Cell Biol. 4(1):45-52. PMID:8453064
  22. [ + ] Gartner J, et al. (1993) "Localization of the 70-kDa peroxisomal membrane protein to human 1p21-p22 and mouse 3." Genomics. 15(2):412-414. PMID:8449508
  23. [ + ] Gartner J, et al. (1992) "Mutations in the 70K peroxisomal membrane protein gene in Zellweger syndrome." Nat Genet. 1(1):16-23. PMID:1301993
  24. [ + ] Kamijo K, et al. (1992) "Nucleotide sequence of the human 70 kDa peroxisomal membrane protein: a member of ATP-binding cassette transporters." Biochim Biophys Acta. 1129(3):323-327. PMID:1536884
  25. [ + ] Gartner J, et al. (1992) "A polymorphic synonymous mutation (K54K) in the human 70 kD peroxisomal membrane protein gene (PMP1)." Hum Mol Genet. 1(8):654. PMID:1301179