AADACL1 | GeneID:57552 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 57552 Official Symbol AADACL1
Locus N/A Gene Type protein-coding
Synonyms NCEH
Full Name arylacetamide deacetylase-like 1
Description arylacetamide deacetylase-like 1
Chromosome 3q26.31
Also Known As neutral cholesterol ester hydrolase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23251

ID Symbol Protein Species
GeneID:57552 AADACL1 NP_065843.3 Homo sapiens
GeneID:177791 esterase NP_501702.1 Caenorhabditis elegans
GeneID:181188 esterase NP_001024899.1 Caenorhabditis elegans
GeneID:189866 Y43F8A.3 NP_507771.2 Caenorhabditis elegans
GeneID:320024 Aadacl1 NP_848887.1 Mus musculus
GeneID:429158 AADACL1 XP_426713.2 Gallus gallus
GeneID:432374 zgc:92416 NP_001002303.1 Danio rerio
GeneID:470998 AADACL1 XP_526382.2 Pan troglodytes
GeneID:488171 AADACL1 XP_545295.2 Canis lupus familiaris
GeneID:534212 AADACL1 XP_584246.3 Bos taurus
GeneID:777713 zgc:153038 NP_001071229.1 Danio rerio
GeneID:797436 LOC797436 XP_001335382.1 Danio rerio

Exon, Intron and UTRs

Exon, Intron and UTRs of AADACL1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADACL1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0004091 Function carboxylesterase activity
GO:0042301 Function phosphate binding
GO:0017171 Function serine hydrolase activity
GO:0016042 Process lipid catabolic process
GO:0008152 Process metabolic process
GO:0006470 Process protein amino acid dephosphorylation
GO:0006805 Process xenobiotic metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020792  UCSC Browser NP_065843

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000273512 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000273512 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000273512 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000273512 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000273512 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000273512 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000273512 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000273512 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000273512 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AADACL1 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of AADACL1 mRNA
17484886
diazoxon
  • diazoxon results in decreased activity of AADACL1 protein
16449251
Dietary Fats
  • Dietary Fats results in increased expression of AADACL1 mRNA
18042831
ethyl octylphosphonofluoridate
  • ethyl octylphosphonofluoridate results in decreased activity of AADACL1 protein
16449251
Fenitrothion
  • Fenitrothion analog results in decreased activity of AADACL1 protein
16449251
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of AADACL1 mRNA
17183730
O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate
  • O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate analog results in decreased activity of AADACL1 protein
  • O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in decreased activity of AADACL1 protein
16449251
palm oil
  • palm oil results in increased expression of AADACL1 mRNA
18042831
Paraoxon
  • Paraoxon results in decreased activity of AADACL1 protein
16449251
pirinixic acid
  • pirinixic acid results in increased expression of AADACL1 mRNA
18301758
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of AADACL1 mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Atherosclerosis inferred via Paraoxon 16391483
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 16097048, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 16239168, 61145, 12631006, 12795759
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15027814, 15968718, 16227642, 15998439, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 17334410, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 16248980, 15925388, 17557913, 18156304, 16638106, 18418968, 12632512, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 17766677, 12666154, 18395095, 17976157, 17805973, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 15830285, 16964402, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17562736, 16177239, 15968718, 16227642, 14986274, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Okazaki H, et al. (2008) "Identification of neutral cholesterol ester hydrolase, a key enzyme removing cholesterol from macrophages." J Biol Chem. 283(48):33357-33364. PMID:18782767
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Herman AG, et al. (2006) "Enzyme annotation with chemical tools." Chem Biol. 13(10):1013-1014. PMID:17052604
  4. [ + ] Chiang KP, et al. (2006) "An enzyme that regulates ether lipid signaling pathways in cancer annotated by multidimensional profiling." Chem Biol. 13(10):1041-1050. PMID:17052608
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Nagase T, et al. (2000) "Prediction of the coding sequences of unidentified human genes. XVI. The complete sequences of 150 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 7(1):65-73. PMID:10718198