AADACL1 | GeneID:57552 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 57552 | Official Symbol | AADACL1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | NCEH | ||
| Full Name | arylacetamide deacetylase-like 1 | ||
| Description | arylacetamide deacetylase-like 1 | ||
| Chromosome | 3q26.31 | ||
| Also Known As | neutral cholesterol ester hydrolase | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 23251
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:57552 | AADACL1 | NP_065843.3 | Homo sapiens |
| GeneID:177791 | esterase | NP_501702.1 | Caenorhabditis elegans |
| GeneID:181188 | esterase | NP_001024899.1 | Caenorhabditis elegans |
| GeneID:189866 | Y43F8A.3 | NP_507771.2 | Caenorhabditis elegans |
| GeneID:320024 | Aadacl1 | NP_848887.1 | Mus musculus |
| GeneID:429158 | AADACL1 | XP_426713.2 | Gallus gallus |
| GeneID:432374 | zgc:92416 | NP_001002303.1 | Danio rerio |
| GeneID:470998 | AADACL1 | XP_526382.2 | Pan troglodytes |
| GeneID:488171 | AADACL1 | XP_545295.2 | Canis lupus familiaris |
| GeneID:534212 | AADACL1 | XP_584246.3 | Bos taurus |
| GeneID:777713 | zgc:153038 | NP_001071229.1 | Danio rerio |
| GeneID:797436 | LOC797436 | XP_001335382.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005783 | Component | endoplasmic reticulum |
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005792 | Component | microsome |
| GO:0004091 | Function | carboxylesterase activity |
| GO:0042301 | Function | phosphate binding |
| GO:0017171 | Function | serine hydrolase activity |
| GO:0016042 | Process | lipid catabolic process |
| GO:0008152 | Process | metabolic process |
| GO:0006470 | Process | protein amino acid dephosphorylation |
| GO:0006805 | Process | xenobiotic metabolic process |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000273512 | MI0003148 | hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU |
| ENST00000273512 | MI0003539 | mmu-miR-291b-3p | AAAGUGCAUCCAUUUUGUUUGU |
| ENST00000273512 | MI0002401 | mmu-miR-466a-3p | UAUACAUACACGCACACAUAAGA |
| ENST00000273512 | MI0005504 | mmu-miR-466b-3-3p | AAUACAUACACGCACACAUAAGA |
| ENST00000273512 | MI0005546 | mmu-miR-466d-3p | UAUACAUACACGCACACAUAG |
| ENST00000273512 | MI0005507 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000273512 | MI0005508 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000273512 | MI0005509 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000273512 | MI0004554 | mmu-miR-759 | GCAGAGUGCAAACAAUUUUGAC |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Acetaminophen | |
|
|
| Carbon Tetrachloride | |
|
|
| diazoxon | |
|
|
| Dietary Fats | |
|
|
| ethyl octylphosphonofluoridate | |
|
|
| Fenitrothion | |
|
|
| Hydralazine | |
|
|
| O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate | |
|
|
| palm oil | |
|
|
| Paraoxon | |
|
|
| pirinixic acid | |
|
|
| Valproic Acid | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Okazaki H, et al. (2008) "Identification of neutral cholesterol ester hydrolase, a key enzyme removing cholesterol from macrophages." J Biol Chem. 283(48):33357-33364. PMID:18782767 - [
] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560 - [
] Herman AG, et al. (2006) "Enzyme annotation with chemical tools." Chem Biol. 13(10):1013-1014. PMID:17052604 - [
] Chiang KP, et al. (2006) "An enzyme that regulates ether lipid signaling pathways in cancer annotated by multidimensional profiling." Chem Biol. 13(10):1041-1050. PMID:17052608 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Nagase T, et al. (2000) "Prediction of the coding sequences of unidentified human genes. XVI. The complete sequences of 150 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 7(1):65-73. PMID:10718198
Unstable lipid-rich plaques in atherosclerosis are characterized by the accumulation of macrophage foam cells loaded with cholesterol ester (CE). Although hormone-sensitive lipase and cholesteryl ester hydrolase (CEH) have been proposed to mediate the hydrolysis of CE in macrophages, circumstantial evidence suggests the presence of other enzymes with neutral cholesterol ester hydrolase (nCEH) activity. Here we show that the murine orthologue of KIAA1363, designated as neutral cholesterol ester hydrolase (NCEH), is a microsomal nCEH with high expression in murine and human macrophages. The effect of various concentrations of NaCl on its nCEH activity resembles that on endogenous nCEH activity of macrophages. RNA silencing of NCEH decreases nCEH activity at least by 50%; conversely, its overexpression inhibits the CE formation in macrophages. Immunohistochemistry reveals that NCEH is expressed in macrophage foam cells in atherosclerotic lesions. These data indicate that NCEH is responsible for a major part of nCEH activity in macrophages and may be a potential therapeutic target for the prevention of atherosclerosis.
By analyzing 1,780,295 5'-end sequences of human full-length cDNAs derived from 164 kinds of oligo-cap cDNA libraries, we identified 269,774 independent positions of transcriptional start sites (TSSs) for 14,628 human RefSeq genes. These TSSs were clustered into 30,964 clusters that were separated from each other by more than 500 bp and thus are very likely to constitute mutually distinct alternative promoters. To our surprise, at least 7674 (52%) human RefSeq genes were subject to regulation by putative alternative promoters (PAPs). On average, there were 3.1 PAPs per gene, with the composition of one CpG-island-containing promoter per 2.6 CpG-less promoters. In 17% of the PAP-containing loci, tissue-specific use of the PAPs was observed. The richest tissue sources of the tissue-specific PAPs were testis and brain. It was also intriguing that the PAP-containing promoters were enriched in the genes encoding signal transduction-related proteins and were rarer in the genes encoding extracellular proteins, possibly reflecting the varied functional requirement for and the restricted expression of those categories of genes, respectively. The patterns of the first exons were highly diverse as well. On average, there were 7.7 different splicing types of first exons per locus partly produced by the PAPs, suggesting that a wide variety of transcripts can be achieved by this mechanism. Our findings suggest that use of alternate promoters and consequent alternative use of first exons should play a pivotal role in generating the complexity required for the highly elaborated molecular systems in humans.
Defining the activity of an enzyme in a cell-based system is preferable to in vitro biochemical techniques requiring extensive purification. Chiang et al. use small molecules, RNA interference, and metabolomics to characterize a novel enzyme upregulated in cancer cells.
Hundreds, if not thousands, of uncharacterized enzymes currently populate the human proteome. Assembly of these proteins into the metabolic and signaling pathways that govern cell physiology and pathology constitutes a grand experimental challenge. Here, we address this problem by using a multidimensional profiling strategy that combines activity-based proteomics and metabolomics. This approach determined that KIAA1363, an uncharacterized enzyme highly elevated in aggressive cancer cells, serves as a central node in an ether lipid signaling network that bridges platelet-activating factor and lysophosphatidic acid. Biochemical studies confirmed that KIAA1363 regulates this pathway by hydrolyzing the metabolic intermediate 2-acetyl monoalkylglycerol. Inactivation of KIAA1363 disrupted ether lipid metabolism in cancer cells and impaired cell migration and tumor growth in vivo. The integrated molecular profiling method described herein should facilitate the functional annotation of metabolic enzymes in any living system.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
We have carried out a human cDNA sequencing project to accumulate information regarding the coding sequences of unidentified human genes. As an extension of the preceding reports, we herein present the entire sequences of 150 cDNA clones of unknown human genes, named KIAA1294 to KIAA1443, from two sets of size-fractionated human adult and fetal brain cDNA libraries. The average sizes of the inserts and corresponding open reading frames of cDNA clones analyzed here reached 4.8 kb and 2.7 kb (910 amino acid residues), respectively. From sequence similarities and protein motifs, 73 predicted gene products were functionally annotated and 97% of them were classified into the following four functional categories: cell signaling/communication, nucleic acid management, cell structure/motility and protein management. Additionally, the chromosomal loci of the genes were assigned by using human-rodent hybrid panels for those genes whose mapping data were not available in the public databases. The expression profiles of the genes were also studied in 10 human tissues, 8 brain regions, spinal cord, fetal brain and fetal liver by reverse transcription-coupled polymerase chain reaction, products of which were quantified by enzyme-linked immunosorbent assay.

