AARS2 | GeneID:57505 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 57505 Official Symbol AARS2
Locus RP11-444E17.1 Gene Type protein-coding
Synonyms AARSL; KIAA1270; MT-ALARS; MTALARS; bA444E17.1
Full Name alanyl-tRNA synthetase 2, mitochondrial (putative)
Description alanyl-tRNA synthetase 2, mitochondrial (putative)
Chromosome 6p21.1
Also Known As OTTHUMP00000016528; OTTHUMP00000039883; alanine tRNA ligase 2, mitochondrial (putative); alanyl-tRNA synthetase 2, mitochondrial; alanyl-tRNA synthetase like
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56897

ID Symbol Protein Species
GeneID:57505 AARS2 NP_065796.1 Homo sapiens
GeneID:224805 Aars2 NP_941010.2 Mus musculus
GeneID:301254 Aars2 XP_236942.4 Rattus norvegicus
GeneID:421436 RCJMB04_28n18 NP_001026227.1 Gallus gallus
GeneID:462733 AARS2 XP_518510.2 Pan troglodytes
GeneID:474920 AARS2 XP_532155.2 Canis lupus familiaris
GeneID:786099 AARS2 XP_001253240.1 Bos taurus
GeneID:792787 si:dkey-240e12.1 XP_001332388.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab72373 Alanyl-tRNA synthetase 2 antibody - C-terminal (ab72373); Rabbit polyclonal to Alanyl-tRNA synthetase 2 - C-terminal
2 abgent AP7559c AARS2 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP7559b AARS2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP14200PU-N AARS2 (C-term); antibody Ab
5 acris AP14201PU-N AARS2 (Center); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of AARS2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AARS2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020745  UCSC Browser NP_065796

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000244571 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000244571 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000244571 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000244571 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000244571 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000244571 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000244571 MI0000459 hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU
ENST00000244571 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000244571 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000244571 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000244571 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000244571 MI0000290 hsa-miR-214* UGCCUGUCUACACUUGCUGUGC
ENST00000244571 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENST00000244571 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000244571 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000244571 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000244571 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000244571 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000244571 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000244571 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000244571 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000244571 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000244571 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000244571 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000244571 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000244571 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000244571 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000244571 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000244571 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENST00000244571 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000244571 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000244571 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000244571 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000244571 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000244571 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000244571 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000244571 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000244571 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000244571 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000244571 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000244571 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000244571 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000244571 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000244571 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Bonnefond L, et al. (2005) "Toward the full set of human mitochondrial aminoacyl-tRNA synthetases: characterization of AspRS and TyrRS." Biochemistry. 44(12):4805-4816. PMID:15779907
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Nakayama M, et al. (2002) "Protein-protein interactions between large proteins: two-hybrid screening using a functionally classified library composed of long cDNAs." Genome Res. 12(11):1773-1784. PMID:12421765
  6. [ + ] Dias Neto E, et al. (2000) "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags." Proc Natl Acad Sci U S A. 97(7):3491-3496. PMID:10737800
  7. [ + ] Nagase T, et al. (1999) "Prediction of the coding sequences of unidentified human genes. XV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 6(5):337-345. PMID:10574462