ABHD6 | GeneID:57406 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 57406 Official Symbol ABHD6
Locus N/A Gene Type protein-coding
Full Name abhydrolase domain containing 6
Description abhydrolase domain containing 6
Chromosome 3p14.3
Also Known As lipase protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23246

ID Symbol Protein Species
GeneID:57406 ABHD6 NP_065727.3 Homo sapiens
GeneID:66082 Abhd6 NP_079617.2 Mus musculus
GeneID:305795 Abhd6 NP_001007681.1 Rattus norvegicus
GeneID:416009 ABHD6 XP_414352.1 Gallus gallus
GeneID:470830 ABHD6 XP_526213.2 Pan troglodytes
GeneID:484712 ABHD6 XP_541828.1 Canis lupus familiaris
GeneID:505283 ABHD6 NP_001068664.1 Bos taurus
GeneID:799085 LOC799085 XP_001339480.1 Danio rerio

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA017283 Anti-ABHD6 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD6 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD6 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0047372 Function acylglycerol lipase activity
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020676  UCSC Browser NP_065727 B2R7Y9   Q9BV23  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000295962 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000295962 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000295962 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000295962 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000295962 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000295962 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000295962 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000295962 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000295962 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENST00000295962 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000295962 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000295962 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000295962 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000295962 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000295962 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000295962 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000295962 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000295962 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000295962 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000295962 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000295962 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENST00000295962 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENST00000295962 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENST00000295962 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000295962 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000295962 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000295962 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000295962 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000295962 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENST00000295962 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENST00000295962 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
  • Acetaminophen affects the expression of ABHD6 mRNA
Dietary Fats
  • Dietary Fats results in increased expression of ABHD6 mRNA
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABHD6 mRNA
  • nitrosobenzylmethylamine results in increased expression of ABHD6 mRNA
palm oil
  • palm oil results in increased expression of ABHD6 mRNA
pirinixic acid
  • pirinixic acid results in increased expression of ABHD6 mRNA
18301758, 17426115
  • Tamoxifen affects the expression of ABHD6 mRNA

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 17242785, 16818667, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 11161223
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15878914, 15547721, 15623463, 15150132, 15264214, 15547733, 16704527, 16510608
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17333356, 16919318, 17681005, 16105132, 11677210, 15861022
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16227642, 15968718, 16177239, 16081117, 17522070, 17562736, 14986274
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Li F, et al. (2009) "An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines." Mol Biol Rep. 36(4):691-696. PMID:18360779
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  7. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298