acadvl | GeneID:573723 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 573723 Official Symbol acadvl
Locus N/A Gene Type protein-coding
Synonyms MGC174519; MGC64067; fb52d04; wu:fb52d04; wu:fc75e01; zgc:64067
Full Name acyl-Coenzyme A dehydrogenase, very long chain
Description acyl-Coenzyme A dehydrogenase, very long chain
Chromosome N/A
Also Known As vlcad
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5

ID Symbol Protein Species
GeneID:37 ACADVL NP_000009.1 Homo sapiens
GeneID:11370 Acadvl NP_059062.1 Mus musculus
GeneID:25363 Acadvl NP_037023.1 Rattus norvegicus
GeneID:37217 CG7461 NP_611409.1 Drosophila melanogaster
GeneID:174180 E04F6.5 NP_001022062.1 Caenorhabditis elegans
GeneID:282130 ACADVL NP_776919.1 Bos taurus
GeneID:489463 ACADVL XP_546581.2 Canis lupus familiaris
GeneID:573723 acadvl NP_997776.1 Danio rerio
GeneID:1275628 AgaP_ENSANGG00000009991 XP_314895.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_212611 NP_997776

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000023089 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000023089 MI0001865 dre-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSDART00000023089 MI0001866 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000023089 MI0001867 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000023089 MI0001868 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000023089 MI0001870 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000023089 MI0001871 dre-let-7e UGAGGUAGUAGAUUGAAUAGUU
ENSDART00000023089 MI0001872 dre-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSDART00000023089 MI0001873 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000023089 MI0001874 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000023089 MI0001875 dre-let-7h UGAGGUAGUAAGUUGUGUUGUU
ENSDART00000023089 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000023089 MI0001962 dre-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSDART00000023089 MI0001963 dre-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSDART00000023089 MI0001980 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000023089 MI0001981 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000023089 MI0001989 dre-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSDART00000023089 MI0001991 dre-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSDART00000023089 MI0001891 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000023089 MI0001892 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000023089 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000023089 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000023089 MI0002036 dre-miR-196b UAGGUAGUUUCAAGUUGUUGGG
ENSDART00000023089 MI0003385 dre-miR-212 UAACAGUCUACAGUCAUGGCU
ENSDART00000023089 MI0002176 dre-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSDART00000023089 MI0002028 dre-miR-462 UAACGGAACCCAUAAUGCAGCU
ENSDART00000023089 MI0004778 dre-miR-733 UGCGUUGGUUUAGCUCAGUGGUU
ENSDART00000023089 MI0004820 xtr-miR-98 UGAGGUAGUAAGUUGUAUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932