Aadac | GeneID:57300 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 57300 Official Symbol Aadac
Locus N/A Gene Type protein-coding
Synonyms Aada
Full Name arylacetamide deacetylase (esterase)
Description arylacetamide deacetylase (esterase)
Chromosome 2q31
Also Known As arylacetamide deacetylase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37436

ID Symbol Protein Species
GeneID:13 AADAC NP_001077.2 Homo sapiens
GeneID:57300 Aadac NP_065413.1 Rattus norvegicus
GeneID:67758 Aadac NP_075872.1 Mus musculus
GeneID:425034 AADACL2 XP_422836.2 Gallus gallus
GeneID:460785 AADAC XP_001145851.1 Pan troglodytes
GeneID:477115 AADAC XP_534309.2 Canis lupus familiaris
GeneID:519557 AADAC NP_001069259.1 Bos taurus
GeneID:100148912 LOC100148912 XP_001923714.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0004091 Function carboxylesterase activity
GO:0019213 Function deacetylase activity
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020538  UCSC Browser NP_065413

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000018761 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSRNOT00000018761 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSRNOT00000018761 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000018761 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSRNOT00000018761 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSRNOT00000018761 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSRNOT00000018761 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSRNOT00000018761 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSRNOT00000018761 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSRNOT00000018761 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSRNOT00000018761 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSRNOT00000018761 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSRNOT00000018761 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000018761 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000018761 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSRNOT00000018761 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSRNOT00000018761 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSRNOT00000018761 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSRNOT00000018761 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSRNOT00000018761 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSRNOT00000018761 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000018761 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSRNOT00000018761 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSRNOT00000018761 MI0005518 mmu-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENSRNOT00000018761 MI0005519 mmu-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSRNOT00000018761 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSRNOT00000018761 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSRNOT00000018761 MI0000886 rno-miR-101a UACAGUACUGUGAUAACUGAA
ENSRNOT00000018761 MI0000648 rno-miR-101b UACAGUACUGUGAUAGCUGAA
ENSRNOT00000018761 MI0000889 rno-miR-106b UAAAGUGCUGACAGUGCAGAU
ENSRNOT00000018761 MI0000616 rno-miR-148b-3p UCAGUGCAUCACAGAACUUUGU
ENSRNOT00000018761 MI0000921 rno-miR-152 UCAGUGCAUGACAGAACUUGG
ENSRNOT00000018761 MI0006131 rno-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENSRNOT00000018761 MI0000638 rno-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSRNOT00000018761 MI0003554 rno-miR-20b-5p CAAAGUGCUCAUAGUGCAGGU
ENSRNOT00000018761 MI0000960 rno-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENSRNOT00000018761 MI0000959 rno-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSRNOT00000018761 MI0000960 rno-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSRNOT00000018761 MI0000963 rno-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSRNOT00000018761 MI0000861 rno-miR-28* CACUAGAUUGUGAGCUCCUGGA
ENSRNOT00000018761 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000018761 MI0003552 rno-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSRNOT00000018761 MI0001731 rno-miR-451 AAACCGUUACCAUUACUGAGUU
ENSRNOT00000018761 MI0006160 rno-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSRNOT00000018761 MI0000641 rno-miR-7a* ACAACAAAUCACAGUCUGCCAU
ENSRNOT00000018761 MI0000880 rno-miR-93 CAAAGUGCUGUUCGUGCAGGUAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  2. [ + ] Trickett JI, et al. (2001) "Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation." J Biol Chem. 276(43):39522-39532. PMID:11481320