Aadac | GeneID:57300 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 57300 | Official Symbol | Aadac |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | Aada | ||
| Full Name | arylacetamide deacetylase (esterase) | ||
| Description | arylacetamide deacetylase (esterase) | ||
| Chromosome | 2q31 | ||
| Also Known As | arylacetamide deacetylase | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37436
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:13 | AADAC | NP_001077.2 | Homo sapiens |
| GeneID:57300 | Aadac | NP_065413.1 | Rattus norvegicus |
| GeneID:67758 | Aadac | NP_075872.1 | Mus musculus |
| GeneID:425034 | AADACL2 | XP_422836.2 | Gallus gallus |
| GeneID:460785 | AADAC | XP_001145851.1 | Pan troglodytes |
| GeneID:477115 | AADAC | XP_534309.2 | Canis lupus familiaris |
| GeneID:519557 | AADAC | NP_001069259.1 | Bos taurus |
| GeneID:100148912 | LOC100148912 | XP_001923714.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005783 | Component | endoplasmic reticulum |
| GO:0005789 | Component | endoplasmic reticulum membrane |
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005792 | Component | microsome |
| GO:0004091 | Function | carboxylesterase activity |
| GO:0019213 | Function | deacetylase activity |
| GO:0006629 | Process | lipid metabolic process |
| GO:0008152 | Process | metabolic process |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000018761 | MI0003144 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENSRNOT00000018761 | MI0003147 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENSRNOT00000018761 | MI0003178 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENSRNOT00000018761 | MI0003182 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENSRNOT00000018761 | MI0003151 | hsa-miR-519b-3p | AAAGUGCAUCCUUUUAGAGGUU |
| ENSRNOT00000018761 | MI0003148 | hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU |
| ENSRNOT00000018761 | MI0003162 | hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUG |
| ENSRNOT00000018761 | MI0003145 | hsa-miR-519e | AAGUGCCUCCUUUUAGAGUGUU |
| ENSRNOT00000018761 | MI0003155 | hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG |
| ENSRNOT00000018761 | MI0003158 | hsa-miR-520c-3p | AAAGUGCUUCCUUUUAGAGGGU |
| ENSRNOT00000018761 | MI0003143 | hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG |
| ENSRNOT00000018761 | MI0003612 | hsa-miR-548a-5p | AAAAGUAAUUGCGAGUUUUACC |
| ENSRNOT00000018761 | MI0003668 | hsa-miR-548d-5p | AAAAGUAAUUGUGGUUUUUGCC |
| ENSRNOT00000018761 | MI0003671 | hsa-miR-548d-5p | AAAAGUAAUUGUGGUUUUUGCC |
| ENSRNOT00000018761 | MI0003583 | hsa-miR-576-3p | AAGAUGUGGAAAAAUUGGAAUC |
| ENSRNOT00000018761 | MI0003641 | hsa-miR-627 | GUGAGUCUCUAAGAAAAGAGGA |
| ENSRNOT00000018761 | MI0003642 | hsa-miR-628-3p | UCUAGUAAGAGUGGCAGUCGA |
| ENSRNOT00000018761 | MI0003648 | hsa-miR-633 | CUAAUAGUAUCUACCACAAUAAA |
| ENSRNOT00000018761 | MI0003666 | hsa-miR-651 | UUUAGGAUAAGCUUGACUUUUG |
| ENSRNOT00000018761 | MI0003834 | hsa-miR-769-5p | UGAGACCUCUGGGUUCUGAGCU |
| ENSRNOT00000018761 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENSRNOT00000018761 | MI0005513 | mmu-miR-467d | UAAGUGCGCGCAUGUAUAUGCG |
| ENSRNOT00000018761 | MI0006128 | mmu-miR-467e | AUAAGUGUGAGCAUGUAUAUGU |
| ENSRNOT00000018761 | MI0005518 | mmu-miR-574-5p | UGAGUGUGUGUGUGUGAGUGUGU |
| ENSRNOT00000018761 | MI0005519 | mmu-miR-590-5p | GAGCUUAUUCAUAAAAGUGCAG |
| ENSRNOT00000018761 | MI0004666 | mmu-miR-669b | AGUUUUGUGUGCAUGUGCAUGU |
| ENSRNOT00000018761 | MI0005204 | mmu-miR-805 | GAAUUGAUCAGGACAUAGGG |
| ENSRNOT00000018761 | MI0000886 | rno-miR-101a | UACAGUACUGUGAUAACUGAA |
| ENSRNOT00000018761 | MI0000648 | rno-miR-101b | UACAGUACUGUGAUAGCUGAA |
| ENSRNOT00000018761 | MI0000889 | rno-miR-106b | UAAAGUGCUGACAGUGCAGAU |
| ENSRNOT00000018761 | MI0000616 | rno-miR-148b-3p | UCAGUGCAUCACAGAACUUUGU |
| ENSRNOT00000018761 | MI0000921 | rno-miR-152 | UCAGUGCAUGACAGAACUUGG |
| ENSRNOT00000018761 | MI0006131 | rno-miR-17 | CAAAGUGCUUACAGUGCAGGUAG |
| ENSRNOT00000018761 | MI0000638 | rno-miR-20a | UAAAGUGCUUAUAGUGCAGGUAG |
| ENSRNOT00000018761 | MI0003554 | rno-miR-20b-5p | CAAAGUGCUCAUAGUGCAGGU |
| ENSRNOT00000018761 | MI0000960 | rno-miR-219-2-3p | AGAAUUGUGGCUGGACAUCUGU |
| ENSRNOT00000018761 | MI0000959 | rno-miR-219-5p | UGAUUGUCCAAACGCAAUUCU |
| ENSRNOT00000018761 | MI0000960 | rno-miR-219-5p | UGAUUGUCCAAACGCAAUUCU |
| ENSRNOT00000018761 | MI0000963 | rno-miR-223 | UGUCAGUUUGUCAAAUACCCC |
| ENSRNOT00000018761 | MI0000861 | rno-miR-28* | CACUAGAUUGUGAGCUCCUGGA |
| ENSRNOT00000018761 | MI0000965 | rno-miR-291a-3p | AAAGUGCUUCCACUUUGUGUGCC |
| ENSRNOT00000018761 | MI0003552 | rno-miR-374 | AUAUAAUACAACCUGCUAAGUG |
| ENSRNOT00000018761 | MI0001731 | rno-miR-451 | AAACCGUUACCAUUACUGAGUU |
| ENSRNOT00000018761 | MI0006160 | rno-miR-708 | AAGGAGCUUACAAUCUAGCUGGG |
| ENSRNOT00000018761 | MI0000641 | rno-miR-7a* | ACAACAAAUCACAGUCUGCCAU |
| ENSRNOT00000018761 | MI0000880 | rno-miR-93 | CAAAGUGCUGUUCGUGCAGGUAG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Trickett JI, et al. (2001) "Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation." J Biol Chem. 276(43):39522-39532. PMID:11481320
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
In the current study, we have determined the cDNA and the genomic sequences of the arylacetamide deacetylase (AADA) gene in mice and rats. The AADA genes in the rat and mouse consist of five exons and have 2.4 kilobases of homologous promoter sequence upstream of the initiating ATG codon. AADA mRNA is expressed in hepatocytes, intestinal mucosal cells (probably enterocytes), the pancreas and also the adrenal gland. In mice, there is a diurnal rhythm in hepatic AADA mRNA concentration, with a maximum 10 h into the light (post-absorptive) phase. This diurnal regulation is attenuated in peroxisome proliferator-activated receptor alpha knockout mice. Intestinal but not hepatic AADA mRNA was increased following oral administration of the fibrate, Wy-14,643. The homology of AADA with hormone-sensitive lipase and the tissue distribution of AADA are consistent with the view that AADA plays a role in promoting the mobilization of lipids from intracellular stores and in the liver for assembling VLDL. This hypothesis is supported by parallel changes in AADA gene expression in animals with insulin-deficient diabetes and following treatment with orotic acid.