abl2 | GeneID:570636 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 570636 Official Symbol abl2
Locus CH211-80A15.2 Gene Type protein-coding
Synonyms cb272
Full Name v-abl Abelson murine leukemia viral oncogene homolog 2
Description v-abl Abelson murine leukemia viral oncogene homolog 2
Chromosome N/A
Also Known As arg tyrosine kinase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5278

ID Symbol Protein Species
GeneID:27 ABL2 NP_009298.1 Homo sapiens
GeneID:11352 Abl2 NP_033725.2 Mus musculus
GeneID:304883 Abl2 XP_222768.4 Rattus norvegicus
GeneID:395410 ABL2 XP_422269.2 Gallus gallus
GeneID:457552 ABL2 XP_001156169.1 Pan troglodytes
GeneID:480052 ABL2 XP_860695.1 Canis lupus familiaris
GeneID:511845 ABL2 XP_001253285.1 Bos taurus
GeneID:570636 abl2 XP_001923500.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0016301 Function kinase activity
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004672 Function protein kinase activity
GO:0004713 Function protein tyrosine kinase activity
GO:0016740 Function transferase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001122705 NP_001116177
2 XM_001923465 XP_001923500

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000041697 MI0001918 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000041697 MI0001919 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000041697 MI0001920 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000041697 MI0001921 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000098150 MI0001989 dre-miR-132* ACCGUGGCAUUAGAUUGUUACU
ENSDART00000098150 MI0001918 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000098150 MI0001919 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000098150 MI0001920 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000098150 MI0001921 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene