abcg2b | GeneID:570453 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 570453 Official Symbol abcg2b
Locus DKEY-20I6.4 Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 2b
Description ATP-binding cassette, sub-family G (WHITE), member 2b
Chromosome N/A
Also Known As ATP-binding cassette transporter sub-family G member 2b
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 103920

ID Symbol Protein Species
GeneID:569858 abcg2c NP_001034728.2 Danio rerio
GeneID:570453 abcg2b NP_001034155.1 Danio rerio
GeneID:828850 AT4G27420 NP_194472.2 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001039066 NP_001034155

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000091798 MI0001363 dre-miR-10a* CAAAUUCGUGUCUUGGGGAAUA
ENSDART00000091798 MI0001982 dre-miR-129 CUUUUUGCGGUCUGGGCUUGCU
ENSDART00000091798 MI0001983 dre-miR-129 CUUUUUGCGGUCUGGGCUUGCU
ENSDART00000091798 MI0002015 dre-miR-148 UCAGUGCAUUACAGAACUUUGU
ENSDART00000091798 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000091798 MI0001923 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000091798 MI0001925 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000091798 MI0001926 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000091798 MI0004770 dre-miR-726 UUCACUACUAGCAGAACUCGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kobayashi I, et al. (2008) "Characterization and localization of side population (SP) cells in zebrafish kidney hematopoietic tissue." Blood. 111(3):1131-1137. PMID:17932252
  2. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  3. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856