abcg2c | GeneID:569858 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 569858 Official Symbol abcg2c
Locus N/A Gene Type protein-coding
Synonyms MGC152695; im:6903440
Full Name ATP-binding cassette, sub-family G (WHITE), member 2c
Description ATP-binding cassette, sub-family G (WHITE), member 2c
Chromosome N/A
Also Known As ATP-binding cassette transporter sub-family G member 2c
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 103920

ID Symbol Protein Species
GeneID:569858 abcg2c NP_001034728.2 Danio rerio
GeneID:570453 abcg2b NP_001034155.1 Danio rerio
GeneID:828850 AT4G27420 NP_194472.2 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001039639 NP_001034728

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000032322 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000032322 MI0001865 dre-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSDART00000032322 MI0001866 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000032322 MI0001867 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000032322 MI0001868 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000032322 MI0001870 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000032322 MI0001871 dre-let-7e UGAGGUAGUAGAUUGAAUAGUU
ENSDART00000032322 MI0001872 dre-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSDART00000032322 MI0001873 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000032322 MI0001874 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000032322 MI0001875 dre-let-7h UGAGGUAGUAAGUUGUGUUGUU
ENSDART00000032322 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000032322 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000032322 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000032322 MI0002036 dre-miR-196b UAGGUAGUUUCAAGUUGUUGGG
ENSDART00000032322 MI0001376 dre-miR-203a GUGAAAUGUUUAGGACCACUUG
ENSDART00000032322 MI0002041 dre-miR-203b GUGAAAUGUUCAGGACCACUUG
ENSDART00000032322 MI0001378 dre-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSDART00000032322 MI0004820 xtr-miR-98 UGAGGUAGUAAGUUGUAUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kobayashi I, et al. (2008) "Characterization and localization of side population (SP) cells in zebrafish kidney hematopoietic tissue." Blood. 111(3):1131-1137. PMID:17932252
  2. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  3. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932