aadacl4 | GeneID:569798 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 569798 Official Symbol aadacl4
Locus N/A Gene Type protein-coding
Synonyms
Full Name arylacetamide deacetylase-like 4
Description arylacetamide deacetylase-like 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 82530

ID Symbol Protein Species
GeneID:313688 RGD1565761 XP_233640.4 Rattus norvegicus
GeneID:343066 AADACL4 NP_001013652.1 Homo sapiens
GeneID:419479 AADACL4 XP_417635.2 Gallus gallus
GeneID:429936 LOC429936 XP_427491.2 Gallus gallus
GeneID:435815 OTTMUSG00000010747 NP_001074717.1 Mus musculus
GeneID:469815 AADACL4 XP_525200.2 Pan troglodytes
GeneID:569798 aadacl4 XP_698297.1 Danio rerio
GeneID:607688 AADACL4 XP_849554.1 Canis lupus familiaris
GeneID:768457 AADACL4 XP_001231394.1 Gallus gallus
GeneID:768489 LOC768489 XP_001231457.1 Gallus gallus
GeneID:768580 LOC768580 XP_001231604.1 Gallus gallus
GeneID:768597 LOC768597 XP_001231631.1 Gallus gallus
GeneID:768647 LOC768647 XP_001231701.1 Gallus gallus
GeneID:768668 AADACL3 XP_001231735.1 Gallus gallus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_693205 XP_698297

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000065851 MI0002009 dre-miR-144 UACAGUAUAGAUGAUGUACU
ENSDART00000065851 MI0001379 dre-miR-210 CUGUGCGUGUGACAGCGGCUAA
ENSDART00000065851 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000065851 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932