0610031J06Rik | GeneID:56700 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 56700 Official Symbol 0610031J06Rik
Locus N/A Gene Type protein-coding
Synonyms AB027141; NCU-G1
Full Name RIKEN cDNA 0610031J06 gene
Description RIKEN cDNA 0610031J06 gene
Chromosome 3 F1
Also Known As kidney predominant protein NCU-G1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10562

ID Symbol Protein Species
GeneID:56700 0610031J06Rik NP_064387.1 Mus musculus
GeneID:112770 C1orf85 NP_653181.1 Homo sapiens
GeneID:295231 RGD1303130 NP_001004226.1 Rattus norvegicus
GeneID:447841 zgc:92308 NP_001004580.1 Danio rerio
GeneID:457391 LOC457391 XP_513881.2 Pan troglodytes
GeneID:612143 LOC612143 XP_854965.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_020003  UCSC Browser NP_064387

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000001454 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSMUST00000001454 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSMUST00000001454 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSMUST00000001454 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSMUST00000001454 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSMUST00000001454 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSMUST00000001454 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSMUST00000001454 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSMUST00000001454 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSMUST00000001454 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSMUST00000001454 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSMUST00000001454 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSMUST00000001454 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSMUST00000001454 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSMUST00000001454 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSMUST00000001454 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSMUST00000001454 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSMUST00000001454 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSMUST00000001454 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSMUST00000001454 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSMUST00000001454 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSMUST00000001454 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSMUST00000001454 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSMUST00000001454 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSMUST00000001454 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSMUST00000001454 MI0000151 mmu-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENSMUST00000001454 MI0000725 mmu-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSMUST00000001454 MI0000158 mmu-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSMUST00000001454 MI0000693 mmu-miR-139-3p UGGAGACGCGGCCCUGUUGGAG
ENSMUST00000001454 MI0000687 mmu-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENSMUST00000001454 MI0000226 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSMUST00000001454 MI0000229 mmu-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSMUST00000001454 MI0000567 mmu-miR-18a* ACUGCCCUAAGUGCUCCUUCUG
ENSMUST00000001454 MI0000236 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000001454 MI0000733 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000001454 MI0000243 mmu-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENSMUST00000001454 MI0000248 mmu-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSMUST00000001454 MI0000696 mmu-miR-212 UAACAGUCUCCAGUCACGGCCA
ENSMUST00000001454 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSMUST00000001454 MI0000394 mmu-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSMUST00000001454 MI0005488 mmu-miR-297a* UAUACAUACACACAUACCCAUA
ENSMUST00000001454 MI0005489 mmu-miR-297a* UAUACAUACACACAUACCCAUA
ENSMUST00000001454 MI0000595 mmu-miR-324-3p CCACUGCCCCAGGUGCUGCU
ENSMUST00000001454 MI0000595 mmu-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSMUST00000001454 MI0000597 mmu-miR-325* CCUAGUAGGUGCUCAGUAAGUGU
ENSMUST00000001454 MI0000598 mmu-miR-326 CCUCUGGGCCCUUCCUCCAGU
ENSMUST00000001454 MI0000603 mmu-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSMUST00000001454 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000001454 MI0000621 mmu-miR-339-3p UGAGCGCCUCGGCGACAGAGCCG
ENSMUST00000001454 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSMUST00000001454 MI0000632 mmu-miR-345-5p GCUGACCCCUAGUCCAGUGCUU
ENSMUST00000001454 MI0000768 mmu-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSMUST00000001454 MI0001645 mmu-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSMUST00000001454 MI0000799 mmu-miR-382* UCAUUCACGGACAACACUUUUU
ENSMUST00000001454 MI0005496 mmu-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENSMUST00000001454 MI0001524 mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENSMUST00000001454 MI0001525 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSMUST00000001454 MI0004705 mmu-miR-450b-3p AUUGGGAACAUUUUGCAUGCAU
ENSMUST00000001454 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSMUST00000001454 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSMUST00000001454 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSMUST00000001454 MI0003484 mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG
ENSMUST00000001454 MI0003492 mmu-miR-485 AGAGGCUGGCCGUGAUGAAUUC
ENSMUST00000001454 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSMUST00000001454 MI0004706 mmu-miR-505 CGUCAACACUUGCUGGUUUUCU
ENSMUST00000001454 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSMUST00000001454 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000001454 MI0003206 mmu-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSMUST00000001454 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSMUST00000001454 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSMUST00000001454 MI0004258 mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA
ENSMUST00000001454 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSMUST00000001454 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSMUST00000001454 MI0004129 mmu-miR-758 UUUGUGACCUGGUCCACUA
ENSMUST00000001454 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSMUST00000001454 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Wheeler DL, et al. (2001) "Database resources of the National Center for Biotechnology Information." Nucleic Acids Res. 29(1):11-16. PMID:11125038
  8. [ + ] Kawamura T, et al. (2001) "cDNA of a novel mRNA expressed predominantly in mouse kidney." Biochem Genet. 39(1-2):33-42. PMID:11444019
  9. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  10. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  11. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  12. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  13. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548