abcb6 | GeneID:564067 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 564067 Official Symbol abcb6
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 6
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11375

ID Symbol Protein Species
GeneID:10058 ABCB6 NP_005680.1 Homo sapiens
GeneID:41925 CG4225 NP_650503.1 Drosophila melanogaster
GeneID:74104 Abcb6 NP_076221.1 Mus musculus
GeneID:140669 Abcb6 NP_542149.1 Rattus norvegicus
GeneID:176540 hmt-1 NP_001022812.1 Caenorhabditis elegans
GeneID:459959 ABCB6 XP_001161097.1 Pan troglodytes
GeneID:478914 ABCB6 XP_536073.2 Canis lupus familiaris
GeneID:564067 abcb6 XP_692515.3 Danio rerio
GeneID:783257 ABCB6 XP_001251072.1 Bos taurus
GeneID:812037 PF14_0455 XP_001348629.1 Plasmodium falciparum
GeneID:1269280 AgaP_AGAP002278 XP_307900.2 Anopheles gambiae
GeneID:2675723 MGG_05190 XP_359587.2 Magnaporthe grisea
GeneID:2704167 NCU00010.1 XP_322096.1 Neurospora crassa
GeneID:3361134 hmt1 NP_588371.2 Schizosaccharomyces pombe

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001145693 NP_001139165
2 XM_687423 XP_692515

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000092324 MI0001961 dre-miR-101b UACAGUACUAUGAUAACUGAAG
ENSDART00000092324 MI0001897 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000092324 MI0001898 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000092324 MI0001907 dre-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSDART00000092324 MI0001899 dre-miR-20b CAAAGUGCUCACAGUGCAGGUAG
ENSDART00000092324 MI0001720 dre-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSDART00000092324 MI0004822 xtr-miR-106 AAAAGUGCUUAUAGUGCAGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  3. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932