a1cf | GeneID:562916 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 562916 Official Symbol a1cf
Locus N/A Gene Type protein-coding
Synonyms
Full Name apobec1 complementation factor
Description apobec1 complementation factor
Chromosome N/A
Also Known As acf
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_680086 XP_685178
2 XM_702707 XP_707799

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000010358 MI0001897 dre-miR-17a* ACUGCAGUGGAGGCACUUCUAG
ENSDART00000010358 MI0004922 xtr-miR-33a GUGCAUUGUAGUUGCAUUG
ENSDART00000010358 MI0004923 xtr-miR-33b GUGCAUUGUUGUUGCAUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Cheng W, et al. (2006) "HNF factors form a network to regulate liver-enriched genes in zebrafish." Dev Biol. 294(2):482-496. PMID:16631158
  2. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376