Fxyd1 | GeneID:56188 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 56188 Official Symbol Fxyd1
Locus N/A Gene Type protein-coding
Synonyms 0610012C17Rik; 1110006M24Rik; PLM; PML
Full Name FXYD domain-containing ion transport regulator 1
Description FXYD domain-containing ion transport regulator 1
Chromosome 7 B1
Also Known As phospholemman
Summary This gene encodes a member of the FXYD family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity and act as an accessory protein of Na,K-ATPase. Alternative splicing of this gene results in multiple transcript variants which encode the same protein. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3691

ID Symbol Protein Species
GeneID:5348 FXYD1 NP_005022.2 Homo sapiens
GeneID:56188 Fxyd1 NP_062376.1 Mus musculus
GeneID:58971 Fxyd1 NP_113836.1 Rattus norvegicus
GeneID:476487 FXYD1 XP_533697.1 Canis lupus familiaris
GeneID:616139 FXYD1 NP_001069878.1 Bos taurus
GeneID:747770 FXYD1 XP_001158254.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab67761 PML Protein antibody (ab67761); Rabbit polyclonal to PML Protein
2 abcam ab50637 PML Protein antibody [PML-97] (ab50637); Mouse monoclonal [PML-97] to PML Protein
3 abcam ab38685 FXYD1 antibody [41AT858.235] (ab38685); Mouse monoclonal [41AT858.235] to FXYD1
4 abcam ab53773 PML Protein antibody (ab53773); Rabbit polyclonal to PML Protein
5 abgent AP3286a Mouse Phospho-PLM-S88 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP3287a Mouse Phospho-PLM-S83 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP1126a Mouse PLM Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AM1120a Phospho-PLM-S68 Antibody; Purified Mouse Monoclonal Antibody (Mab)
9 acris AP12737PU-N PLM pSer88; antibody Ab
10 acris AP11161PU-N PLM (N-term); antibody Ab
11 acris AP12738PU-N PLM pSer83; antibody Ab
12 acris AM11023PU-N PLM pSer68; antibody Ab

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005254 Function chloride channel activity
GO:0031404 Function chloride ion binding
GO:0005216 Function ion channel activity
GO:0006811 Process ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_019503  UCSC Browser NP_062376
2 NM_052991  UCSC Browser NP_443717
3 NM_052992  UCSC Browser NP_443718
4 NM_194321  UCSC Browser NP_919302

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000039909 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSMUST00000039909 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSMUST00000039909 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSMUST00000039909 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSMUST00000039909 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSMUST00000039909 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSMUST00000039909 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSMUST00000039909 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSMUST00000039909 MI0000151 mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSMUST00000039909 MI0000164 mmu-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSMUST00000039909 MI0000722 mmu-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSMUST00000039909 MI0000169 mmu-miR-145* AUUCCUGGAAAUACUGUUCUUG
ENSMUST00000039909 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSMUST00000039909 MI0000592 mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSMUST00000039909 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSMUST00000039909 MI0004636 mmu-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSMUST00000039909 MI0003538 mmu-miR-503 UAGCAGCGGGAACAGUACUGCAG
ENSMUST00000039909 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSMUST00000039909 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000039909 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000039909 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000039909 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSMUST00000039909 MI0004124 mmu-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSMUST00000039909 MI0004605 mmu-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSMUST00000039909 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSMUST00000039909 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSMUST00000039909 MI0000728 mmu-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSMUST00000039909 MI0000729 mmu-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSMUST00000039909 MI0000730 mmu-miR-7b UGGAAGACUUGUGAUUUUGUUGU
ENSMUST00000039909 MI0000580 mmu-miR-92a* AGGUGGGGAUUGGUGGCAUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Garcia-Rudaz C, et al. (2009) "FXYD1, a modulator of Na,K-ATPase activity, facilitates female sexual development by maintaining gonadotrophin-releasing hormone neuronal excitability." J Neuroendocrinol. 21(2):108-122. PMID:19187398
  2. [ + ] Bell JR, et al. (2009) "Cell volume control in phospholemman (PLM) knockout mice: do cardiac myocytes demonstrate a regulatory volume decrease and is this influenced by deletion of PLM?" Exp Physiol. 94(3):330-343. PMID:19074587
  3. [ + ] Song J, et al. (2008) "Regulation of cardiac myocyte contractility by phospholemman: Na+/Ca2+ exchange versus Na+ -K+ -ATPase." Am J Physiol Heart Circ Physiol. 295(4):H1615-H1625. PMID:18708446
  4. [ + ] Despa S, et al. (2008) "Phospholemman-mediated activation of Na/K-ATPase limits [Na]i and inotropic state during beta-adrenergic stimulation in mouse ventricular myocytes." Circulation. 117(14):1849-1855. PMID:18362230
  5. [ + ] Bell JR, et al. (2008) "Characterization of the phospholemman knockout mouse heart: depressed left ventricular function with increased Na-K-ATPase activity." Am J Physiol Heart Circ Physiol. 294(2):H613-H621. PMID:18065526
  6. [ + ] Meeks MK, et al. (2008) "Phospholemman does not participate in forskolin-induced swine carotid artery relaxation." Physiol Res. 57(5):669-675. PMID:17949246
  7. [ + ] Deng V, et al. (2007) "FXYD1 is an MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice." Hum Mol Genet. 16(6):640-650. PMID:17309881
  8. [ + ] Pavlovic D, et al. (2007) "The intracellular region of FXYD1 is sufficient to regulate cardiac Na/K ATPase." FASEB J. 21(7):1539-1546. PMID:17283221
  9. [ + ] Han F, et al. (2006) "Phospholemman phosphorylation mediates the protein kinase C-dependent effects on Na+/K+ pump function in cardiac myocytes." Circ Res. 99(12):1376-1383. PMID:17095720
  10. [ + ] Tucker AL, et al. (2006) "Altered contractility and [Ca2+]i homeostasis in phospholemman-deficient murine myocytes: role of Na+/Ca2+ exchange." Am J Physiol Heart Circ Physiol. 291(5):H2199-H2209. PMID:16751288
  11. [ + ] Zhang XQ, et al. (2006) "Phospholemman inhibition of the cardiac Na+/Ca2+ exchanger. Role of phosphorylation." J Biol Chem. 281(12):7784-7792. PMID:16434394
  12. [ + ] Geering K, et al. (2006) "FXYD proteins: new regulators of Na-K-ATPase." Am J Physiol Renal Physiol. 290(2):F241-F250. PMID:16403837
  13. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  14. [ + ] Jia LG, et al. (2005) "Hypertrophy, increased ejection fraction, and reduced Na-K-ATPase activity in phospholemman-deficient mice." Am J Physiol Heart Circ Physiol. 288(4):H1982-H1988. PMID:15563542
  15. [ + ] Despa S, et al. (2005) "Phospholemman-phosphorylation mediates the beta-adrenergic effects on Na/K pump function in cardiac myocytes." Circ Res. 97(3):252-259. PMID:16002746
  16. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  17. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  18. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  19. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  20. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  21. [ + ] Bogaev RC, et al. (2001) "Gene structure and expression of phospholemman in mouse." Gene. 271(1):69-79. PMID:11410367
  22. [ + ] Sweadner KJ, et al. (2000) "The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression." Genomics. 68(1):41-56. PMID:10950925
  23. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  24. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  25. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636