abcc9 | GeneID:561160 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 561160 Official Symbol abcc9
Locus DKEY-183C2.3 Gene Type protein-coding
Synonyms si:dkey-183c2.3; sur2
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Chromosome N/A
Also Known As sulfonylurea receptor subunit 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56521

ID Symbol Protein Species
GeneID:10060 ABCC9 NP_064693.2 Homo sapiens
GeneID:20928 Abcc9 NP_035641.1 Mus musculus
GeneID:25560 Abcc9 NP_037172.2 Rattus norvegicus
GeneID:34350 Sur NP_477472.1 Drosophila melanogaster
GeneID:465338 ABCC9 XP_001149571.1 Pan troglodytes
GeneID:486638 ABCC9 XP_852746.1 Canis lupus familiaris
GeneID:522913 ABCC9 XP_601202.3 Bos taurus
GeneID:561160 abcc9 NP_001025325.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0008281 Function sulfonylurea receptor activity
GO:0006813 Process potassium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001030154 NP_001025325

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000013990 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000013990 MI0002016 dre-miR-150 UCUCCCAAUCCUUGUACCAGUG
ENSDART00000013990 MI0001891 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000013990 MI0001892 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000013990 MI0001893 dre-miR-15b UAGCAGCACAUCAUGGUUUGUA
ENSDART00000013990 MI0004779 dre-miR-15c AAGCAGCGCGUCAUGGUUUUC
ENSDART00000013990 MI0001903 dre-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSDART00000013990 MI0001904 dre-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSDART00000013990 MI0001905 dre-miR-19c UGUGCAAAUCCAUGCAAAACUCG
ENSDART00000013990 MI0001906 dre-miR-19d UGUGCAAACCCAUGCAAAACUGA
ENSDART00000013990 MI0002059 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000013990 MI0002060 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000013990 MI0002061 dre-miR-301b CAGUGCAAUAGUAUUGUCAUUG
ENSDART00000013990 MI0002062 dre-miR-301c CAGUGCAAUAGUAUUGUCAUAG
ENSDART00000013990 MI0002076 dre-miR-454b UAGUGCAAUAUUGCUUAUAGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zhang C, et al. (2006) "Identification and characterization of a novel member of the ATP-sensitive K+ channel subunit family, Kir6.3, in zebrafish." Physiol Genomics. 24(3):290-297. PMID:16317080
  2. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  3. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856