aatf | GeneID:559477 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 559477 Official Symbol aatf
Locus N/A Gene Type protein-coding
Synonyms cb109; sb:cb109; wu:fc13d05; zgc:162071
Full Name apoptosis antagonizing transcription factor
Description apoptosis antagonizing transcription factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001083828 NP_001077297

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000028854 MI0001875 dre-let-7h UGAGGUAGUAAGUUGUGUUGUU
ENSDART00000028854 MI0001891 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000028854 MI0001892 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000028854 MI0001893 dre-miR-15b UAGCAGCACAUCAUGGUUUGUA
ENSDART00000028854 MI0004779 dre-miR-15c AAGCAGCGCGUCAUGGUUUUC
ENSDART00000028854 MI0001894 dre-miR-16a UAGCAGCACGUAAAUAUUGGUG
ENSDART00000028854 MI0001895 dre-miR-16b UAGCAGCACGUAAAUAUUGGAG
ENSDART00000028854 MI0001896 dre-miR-16c UAGCAGCAUGUAAAUAUUGGAG
ENSDART00000028854 MI0001368 dre-miR-182 UUUGGCAAUGGUAGAACUCACA
ENSDART00000028854 MI0001368 dre-miR-182* UGGUUCUAGACUUGCCAACUA
ENSDART00000028854 MI0002027 dre-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSDART00000028854 MI0004764 dre-miR-190b UGAUAUGUUUGAUAUUCGGUUG
ENSDART00000028854 MI0002040 dre-miR-202 AGAGGCAUAGGGCAUGGGAAAA
ENSDART00000028854 MI0001381 dre-miR-214 ACAGCAGGCACAGACAGGCAG
ENSDART00000028854 MI0001389 dre-miR-223 UGUCAGUUUGUCAAAUACCCC
ENSDART00000028854 MI0001928 dre-miR-27a UUCACAGUGGCUAAGUUCCGCU
ENSDART00000028854 MI0001929 dre-miR-27b UUCACAGUGGCUAAGUUCUGCA
ENSDART00000028854 MI0001930 dre-miR-27c UUCACAGUGGUUAAGUUCUGC
ENSDART00000028854 MI0001931 dre-miR-27d UUCACAGUGGCUAAGUUCUUCA
ENSDART00000028854 MI0001932 dre-miR-27e UUCACAGUGGCUAAGUUCAGUG
ENSDART00000028854 MI0002177 dre-miR-457a AAGCAGCACAUCAAUAUUGGCA
ENSDART00000028854 MI0002178 dre-miR-457b AAGCAGCACAUAAAUACUGGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932