ACOT13 | GeneID:55856 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 55856 Official Symbol ACOT13
Locus N/A Gene Type protein-coding
Synonyms HT012; MGC4961; PNAS-27; THEM2
Full Name acyl-CoA thioesterase 13
Description acyl-CoA thioesterase 13
Chromosome 6p22.2
Also Known As OTTHUMP00000016090; OTTHUMP00000039398; hypothalamus protein HT012; thioesterase superfamily member 2
Summary This gene encodes a member of the thioesterase superfamily. In humans, the protein co-localizes with microtubules and is essential for sustained cell proliferation. The orthologous mouse protein forms a homotetramer and is associated with mitochondria. The mouse protein functions as a medium- and long-chain acyl-CoA thioesterase. Multiple transcript variants encoding different isoforms have been found for this gene.

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41273

ID Symbol Protein Species
GeneID:38325 CG16986 NP_647732.1 Drosophila melanogaster
GeneID:55856 THEM2 NP_060943.1 Homo sapiens
GeneID:66834 Them2 NP_080066.1 Mus musculus
GeneID:176198 F42H10.6 NP_498872.1 Caenorhabditis elegans
GeneID:291135 Them2 XP_214475.1 Rattus norvegicus
GeneID:421006 THEM2 XP_419092.1 Gallus gallus
GeneID:504870 THEM2 XP_581055.2 Bos taurus
GeneID:564010 them2 NP_001074272.1 Danio rerio
GeneID:610883 THEM2 XP_853542.1 Canis lupus familiaris
GeneID:748065 THEM2 XP_001171713.1 Pan troglodytes
GeneID:839552 AT1G04290 NP_563705.1 Arabidopsis thaliana
GeneID:1269906 AgaP_AGAP007238 XP_308560.2 Anopheles gambiae
GeneID:4335905 Os04g0436100 NP_001052851.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70915 THEM2 antibody (ab70915); Rabbit polyclonal to THEM2
2 abgent AP1460b THEM2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP1460a THEM2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP11448PU-N THEM2 / ACOT13 (C-term); antibody Ab
5 acris AP11447PU-N THEM2 / ACOT13 (N-term); antibody Ab
6 scbt THEM2 THEM2 Antibody / THEM2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACOT13 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACOT13 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_018473  UCSC Browser NP_060943

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000230048 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000230048 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000230048 MI0000074 hsa-miR-19b-1* AGUUUUGCAGGUUUGCAUCCAGC
ENST00000230048 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000230048 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000230048 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000230048 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000230048 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000230048 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000230048 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000230048 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000230048 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000230048 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000230048 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000230048 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000230048 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000230048 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000230048 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000230048 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENST00000230048 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of THEM2 mRNA
17562736
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of THEM2 mRNA
17555576
pirinixic acid
  • pirinixic acid results in increased expression of THEM2 mRNA
18301758

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 11677210, 15861022, 16105132, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 17522070, 16081117, 14986274, 16227642, 15968718, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Wei J, et al. (2009) "Thioesterase superfamily member 2 (Them2)/acyl-CoA thioesterase 13 (Acot13): a homotetrameric hotdog fold thioesterase with selectivity for long-chain fatty acyl-CoAs." Biochem J. 421(2):311-322. PMID:19405909
  2. [ + ] Walker LC, et al. (2008) "Use of expression data and the CGEMS genome-wide breast cancer association study to identify genes that may modify risk in BRCA1/2 mutation carriers." Breast Cancer Res Treat. 112(2):229-236. PMID:18095154
  3. [ + ] Kanno K, et al. (2007) "Interacting proteins dictate function of the minimal START domain phosphatidylcholine transfer protein/StarD2." J Biol Chem. 282(42):30728-30736. PMID:17704541
  4. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  5. [ + ] Cheng Z, et al. (2006) "Crystal structure of human thioesterase superfamily member 2." Biochem Biophys Res Commun. 349(1):172-177. PMID:16934754
  6. [ + ] Cheng Z, et al. (2006) "Human thioesterase superfamily member 2 (hTHEM2) is co-localized with beta-tubulin onto the microtubule." Biochem Biophys Res Commun. 350(4):850-853. PMID:17045243
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Hu RM, et al. (2000) "Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning." Proc Natl Acad Sci U S A. 97(17):9543-9548. PMID:10931946
  12. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548