abcg5 | GeneID:557317 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 557317 Official Symbol abcg5
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 5
Description ATP-binding cassette, sub-family G (WHITE), member 5
Chromosome N/A
Also Known As sterolin 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31909

ID Symbol Protein Species
GeneID:27409 Abcg5 NP_114090.1 Mus musculus
GeneID:42976 CG11069 NP_651307.2 Drosophila melanogaster
GeneID:64240 ABCG5 NP_071881.1 Homo sapiens
GeneID:114628 Abcg5 NP_446206.2 Rattus norvegicus
GeneID:421401 ABCG5 XP_419457.2 Gallus gallus
GeneID:481354 ABCG5 XP_538475.1 Canis lupus familiaris
GeneID:515536 ABCG5 NP_001019718.1 Bos taurus
GeneID:557317 LOC557317 XP_684646.1 Danio rerio
GeneID:1281061 AgaP_AGAP002051 XP_320996.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0031177 Function phosphopantetheine binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001128690 NP_001122162
2 XM_679554 XP_684646

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000091845 MI0001994 dre-miR-133b* GCUGGUCAAAUGGAACCAAGUC
ENSDART00000091845 MI0001904 dre-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSDART00000091845 MI0001906 dre-miR-19d UGUGCAAACCCAUGCAAAACUGA
ENSDART00000091845 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG
ENSDART00000091845 MI0004923 xtr-miR-33b GUGCAUUGUUGUUGCAUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932