acmsd | GeneID:557166 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 557166 Official Symbol acmsd
Locus CH211-157C24.6 Gene Type protein-coding
Synonyms MGC162888; zgc:162888
Full Name aminocarboxymuconate semialdehyde decarboxylase
Description aminocarboxymuconate semialdehyde decarboxylase
Chromosome N/A
Also Known As 2-amino-3-carboxylmuconate-6-semialdehyde decarboxylase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 44520

ID Symbol Protein Species
GeneID:130013 ACMSD NP_612199.2 Homo sapiens
GeneID:171385 Acmsd NP_599199.1 Rattus norvegicus
GeneID:175280 Y71D11A.3 NP_497336.3 Caenorhabditis elegans
GeneID:266645 Acmsd NP_001028213.1 Mus musculus
GeneID:424288 ACMSD XP_422133.2 Gallus gallus
GeneID:459627 ACMSD XP_515804.1 Pan troglodytes
GeneID:476125 ACMSD XP_533332.2 Canis lupus familiaris
GeneID:515030 ACMSD NP_001069162.1 Bos taurus
GeneID:557166 acmsd NP_001082963.1 Danio rerio
GeneID:2684643 MGG_06488 XP_369973.1 Magnaporthe grisea
GeneID:2708210 NCU06417.1 XP_326272.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003824 Function catalytic activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001089494 NP_001082963

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000090609 MI0001958 dre-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSDART00000090609 MI0001959 dre-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSDART00000090609 MI0001966 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001967 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001968 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001969 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001970 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001971 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000090609 MI0001380 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000090609 MI0003387 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000090609 MI0002033 dre-miR-194a UGUAACAGCAACUCCAUGUGG
ENSDART00000090609 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000090609 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000090609 MI0001940 dre-miR-30a UGUAAACAUUCCCGACUGGAAG
ENSDART00000090609 MI0001941 dre-miR-30b UGUAAACAUCCUACACUCAGCU
ENSDART00000090609 MI0001944 dre-miR-30c UGUAAACAUCCUACACUCUCAG
ENSDART00000090609 MI0004785 dre-miR-739 AGGCCGAAGUGGAGAAGGGUU
ENSDART00000090609 MI0001880 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001881 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001882 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001883 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001884 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001885 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSDART00000090609 MI0001886 dre-miR-9 UCUUUGGUUAUCUAGCUGUAUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932