aass | GeneID:556229 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 556229 Official Symbol aass
Locus N/A Gene Type protein-coding
Synonyms
Full Name aminoadipate-semialdehyde synthase
Description aminoadipate-semialdehyde synthase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4212

ID Symbol Protein Species
GeneID:10157 AASS NP_005754.2 Homo sapiens
GeneID:30956 Aass NP_038958.2 Mus musculus
GeneID:34064 CG7144 NP_609150.2 Drosophila melanogaster
GeneID:176842 dehydrogenase NP_499884.1 Caenorhabditis elegans
GeneID:296925 Aass XP_231524.4 Rattus norvegicus
GeneID:417757 AASS XP_416001.2 Gallus gallus
GeneID:472493 AASS XP_527868.2 Pan troglodytes
GeneID:482429 AASS XP_539546.2 Canis lupus familiaris
GeneID:520865 AASS XP_599115.3 Bos taurus
GeneID:556229 aass XP_684074.3 Danio rerio
GeneID:855786 LYS9 NP_014448.1 Saccharomyces cerevisiae
GeneID:1275481 AgaP_AGAP008632 XP_314728.2 Anopheles gambiae
GeneID:2540908 SPBC3B8.03 NP_596411.1 Schizosaccharomyces pombe
GeneID:2678741 MGG_08564 XP_362873.1 Magnaporthe grisea
GeneID:2704923 NCU03748.1 XP_323050.1 Neurospora crassa
GeneID:2892518 KLLA0C18744g XP_453035.1 Kluyveromyces lactis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_678982 XP_684074

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000073502 MI0001889 dre-miR-10d* CAGAUUCGGUUUUAGGGGAGUA
ENSDART00000073502 MI0001890 dre-miR-10d* CAGAUUCGGUUUUAGGGGAGUA
ENSDART00000073502 MI0002003 dre-miR-140 CAGUGGUUUUACCCUAUGGUAG
ENSDART00000073502 MI0002004 dre-miR-141 UAACACUGUCUGGUAACGAUGC
ENSDART00000073502 MI0002005 dre-miR-142a-3p UGUAGUGUUUCCUACUUUAUGGA
ENSDART00000073502 MI0002037 dre-miR-200a UAACACUGUCUGGUAACGAUGU
ENSDART00000073502 MI0002038 dre-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENSDART00000073502 MI0001732 dre-miR-451 AAACCGUUACCAUUACUGAGUU
ENSDART00000073502 MI0002028 dre-miR-462 UAACGGAACCCAUAAUGCAGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kohn M, et al. (2006) "Reconstruction of a 450-My-old ancestral vertebrate protokaryotype." Trends Genet. 22(4):203-210. PMID:16517001
  2. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376