abp1 | GeneID:555401 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 555401 Official Symbol abp1
Locus N/A Gene Type protein-coding
Synonyms MGC154101; si:ch211-286c5.2; zgc:154101
Full Name amiloride binding protein 1 (amine oxidase (copper-containing))
Description amiloride binding protein 1 (amine oxidase (copper-containing))
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68159

ID Symbol Protein Species
GeneID:26 ABP1 NP_001082.2 Homo sapiens
GeneID:65029 Abp1 NP_075224.1 Rattus norvegicus
GeneID:76507 Abp1 NP_083914.1 Mus musculus
GeneID:463895 ABP1 XP_001136583.1 Pan troglodytes
GeneID:475536 ABP1 XP_532759.1 Canis lupus familiaris
GeneID:509751 ABP1 NP_001029533.1 Bos taurus
GeneID:555401 abp1 NP_001071066.1 Danio rerio
GeneID:5049146 MGG_13291 XP_001404794.1 Magnaporthe grisea

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0008131 Function amine oxidase activity
GO:0005507 Function copper ion binding
GO:0046872 Function metal ion binding
GO:0016491 Function oxidoreductase activity
GO:0048038 Function quinone binding
GO:0009308 Process cellular amine metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001077598 NP_001071066

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000087422 MI0001961 dre-miR-101b UACAGUACUAUGAUAACUGAAG
ENSDART00000087422 MI0001908 dre-miR-21 UAGCUUAUCAGACUGGUGUUGGC
ENSDART00000087422 MI0001909 dre-miR-21 UAGCUUAUCAGACUGGUGUUGGC
ENSDART00000087422 MI0001918 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000087422 MI0001919 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000087422 MI0001920 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000087422 MI0001921 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000087422 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG
ENSDART00000087422 MI0004767 dre-miR-723 AAGACAUCAAUUAAAUCUGUGCU
ENSDART00000087422 MI0004767 dre-miR-723* GACAGUUUUAAAUGAUGUUACUUU
ENSDART00000087422 MI0004786 dre-miR-740 AUAAAAAGUGGUAUGGUACAGU
ENSDART00000087422 MI0001361 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000087422 MI0001362 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000087422 MI0001879 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000087422 MI0001360 dre-miR-7b UGGAAGACUUGUGAUUUUGUU
ENSDART00000087422 MI0001880 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000087422 MI0001881 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000087422 MI0001883 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000087422 MI0001884 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000087422 MI0001885 dre-miR-9* UAAAGCUAGAUAACCGAAAGU
ENSDART00000087422 MI0001955 dre-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sundstrom G, et al. (2008) "Phylogenetic and chromosomal analyses of multiple gene families syntenic with vertebrate Hox clusters." BMC Evol Biol. 8():254. PMID:18803835
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932