ACCN4 | GeneID:55515 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 55515 Official Symbol ACCN4
Locus N/A Gene Type protein-coding
Synonyms ASIC4; BNAC4; MGC17248; MGC24860
Full Name amiloride-sensitive cation channel 4, pituitary
Description amiloride-sensitive cation channel 4, pituitary
Chromosome 2q35
Also Known As acid-sensing ion channel 4; amiloride-sensitive cation channel 4; brain sodium channel 4
Summary This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. Alternative splicing at this locus results in two transcript variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11166

ID Symbol Protein Species
GeneID:55515 ACCN4 NP_061144.2 Homo sapiens
GeneID:63882 Accn4 NP_071570.1 Rattus norvegicus
GeneID:174069 degenerin NP_495302.2 Caenorhabditis elegans
GeneID:241118 Accn4 NP_898843.1 Mus musculus
GeneID:407667 accn4b NP_999951.1 Danio rerio
GeneID:407668 accn4a NP_999952.1 Danio rerio
GeneID:488537 ACCN4 XP_853306.1 Canis lupus familiaris
GeneID:743548 ACCN4 XP_001163732.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65700 ACCN4 antibody (ab65700); Rabbit polyclonal to ACCN4
2 abcam ab49023 ACCN4 antibody (ab49023); Rabbit polyclonal to ACCN4
3 scbt ACCN4 ACCN4 Antibody / ACCN4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACCN4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACCN4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0015081 Function sodium ion transmembrane transporter activity
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_018674  UCSC Browser NP_061144
2 NM_182847  UCSC Browser NP_878267

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000358078 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000358078 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000358078 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000358078 MI0003137 hsa-miR-193b AACUGGCCCUCAAAGUCCCGCU
ENST00000358078 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000358078 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000358078 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000358078 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000358078 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000358078 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000358078 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000358078 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000358078 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000358078 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000358078 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000358078 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000358078 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000358078 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENST00000358078 MI0003605 hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC
ENST00000358078 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000358078 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000358078 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000358078 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000358078 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENST00000358078 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000358078 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000358078 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000358078 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000358078 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000358078 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000358078 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000358078 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000358078 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000358078 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000358078 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000358078 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000358078 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000358078 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACCN4 mRNA
17183730
polyphenols
  • polyphenols results in decreased expression of ACCN4 mRNA
16293270
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACCN4 mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Colonic Neoplasms inferred via polyphenols 16293270
Inflammation inferred via polyphenols 16366677
Liver Diseases inferred via polyphenols 16698588
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Donier E, et al. (2008) "Regulation of ASIC activity by ASIC4--new insights into ASIC channel function revealed by a yeast two-hybrid assay." Eur J Neurosci. 28(1):74-86. PMID:18662336
  2. [ + ] Hillier LW, et al. (2005) "Generation and annotation of the DNA sequences of human chromosomes 2 and 4." Nature. 434(7034):724-731. PMID:15815621
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Grunder S, et al. (2001) "Acid-sensing ion channel (ASIC) 4 gene: physical mapping, genomic organisation, and evaluation as a candidate for paroxysmal dystonia." Eur J Hum Genet. 9(9):672-676. PMID:11571555
  6. [ + ] Grunder S, et al. (2000) "A new member of acid-sensing ion channels from pituitary gland." Neuroreport. 11(8):1607-1611. PMID:10852210