acot11 | GeneID:554842 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 554842 Official Symbol acot11
Locus N/A Gene Type protein-coding
Synonyms MGC113011; zgc:113011
Full Name acyl-CoA thioesterase 11
Description acyl-CoA thioesterase 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11977

ID Symbol Protein Species
GeneID:26027 ACOT11 NP_671517.1 Homo sapiens
GeneID:329910 Acot11 NP_079866.2 Mus musculus
GeneID:429108 ACOT11 XP_426664.2 Gallus gallus
GeneID:489576 ACOT11 XP_546696.2 Canis lupus familiaris
GeneID:533609 ACOT11 XP_613069.2 Bos taurus
GeneID:554842 acot11 NP_001093445.1 Danio rerio
GeneID:739330 ACOT11 XP_001152786.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001099975 NP_001093445

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000081058 MI0001965 dre-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSDART00000081058 MI0001984 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000081058 MI0001985 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000081058 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000081058 MI0001987 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000081058 MI0001988 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000081058 MI0002017 dre-miR-152 UCAGUGCAUGACAGAACUUUGG
ENSDART00000081058 MI0001903 dre-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSDART00000081058 MI0001904 dre-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSDART00000081058 MI0001905 dre-miR-19c UGUGCAAAUCCAUGCAAAACUCG
ENSDART00000081058 MI0001906 dre-miR-19d UGUGCAAACCCAUGCAAAACUGA
ENSDART00000081058 MI0002040 dre-miR-202 AGAGGCAUAGGGCAUGGGAAAA
ENSDART00000081058 MI0002062 dre-miR-301c CAGUGCAAUAGUAUUGUCAUAG
ENSDART00000081058 MI0002074 dre-miR-454a UAGUGCAAUAUUGCUAAUAGGG
ENSDART00000081058 MI0002076 dre-miR-454b UAGUGCAAUAUUGCUUAUAGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932