ABHD10 | GeneID:55347 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 55347 Official Symbol ABHD10
Locus N/A Gene Type protein-coding
Synonyms FLJ11342
Full Name abhydrolase domain containing 10
Description abhydrolase domain containing 10
Chromosome 3q13.2
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10173

ID Symbol Protein Species
GeneID:55347 ABHD10 NP_060864.1 Homo sapiens
GeneID:213012 Abhd10 NP_766099.2 Mus musculus
GeneID:303953 Abhd10 XP_001064579.1 Rattus norvegicus
GeneID:418419 ABHD10 XP_416633.2 Gallus gallus
GeneID:478561 ABHD10 XP_535737.2 Canis lupus familiaris
GeneID:515563 ABHD10 NP_001015606.1 Bos taurus
GeneID:563031 LOC563031 XP_691488.2 Danio rerio
GeneID:568517 wu:fb10b08 XP_696942.2 Danio rerio
GeneID:743016 ABHD10 XP_001154093.1 Pan troglodytes

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD10 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD10 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0008233 Function peptidase activity
GO:0008236 Function serine-type peptidase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_018394  UCSC Browser NP_060864

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000273359 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000273359 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000273359 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000273359 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000273359 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000273359 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000273359 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000273359 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000273359 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000273359 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000273359 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Simpson JC, et al. (2000) "Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing." EMBO Rep. 1(3):287-292. PMID:11256614
  7. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863