ABCF3 | GeneID:55324 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 55324 Official Symbol ABCF3
Locus N/A Gene Type protein-coding
Synonyms EST201864; FLJ11198
Full Name ATP-binding cassette, sub-family F (GCN20), member 3
Description ATP-binding cassette, sub-family F (GCN20), member 3
Chromosome 3q27.1
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22784

ID Symbol Protein Species
GeneID:27406 Abcf3 NP_038880.1 Mus musculus
GeneID:40131 CG9330 NP_649129.1 Drosophila melanogaster
GeneID:55324 ABCF3 NP_060828.2 Homo sapiens
GeneID:175873 abcf-3 NP_498339.1 Caenorhabditis elegans
GeneID:287982 Abcf3 NP_001011896.1 Rattus norvegicus
GeneID:424950 ABCF3 XP_422757.2 Gallus gallus
GeneID:460884 ABCF3 XP_516910.2 Pan troglodytes
GeneID:478651 ABCF3 XP_859024.1 Canis lupus familiaris
GeneID:530975 ABCF3 XP_001252189.1 Bos taurus
GeneID:842763 ATGCN3 NP_176636.1 Arabidopsis thaliana
GeneID:850561 GCN20 NP_116664.1 Saccharomyces cerevisiae
GeneID:1267735 ENSANGG00000000043 XP_306294.2 Anopheles gambiae
GeneID:1280669 AgaP_AGAP012005 XP_320530.2 Anopheles gambiae
GeneID:2540597 SPBC29A3.09c NP_595837.1 Schizosaccharomyces pombe
GeneID:2705213 NCU04051.1 XP_323370.1 Neurospora crassa
GeneID:2896717 KLLA0A10857g XP_451473.1 Kluyveromyces lactis
GeneID:4331217 Os02g0826500 NP_001048587.1 Oryza sativa
GeneID:4621026 AGOS_AEL032W NP_984829.1 Eremothecium gossypii
GeneID:5050704 MGG_11547 XP_001411010.1 Magnaporthe grisea
GeneID:100149614 LOC100149614 XP_001922895.1 Danio rerio

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCF3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCF3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_018358  UCSC Browser NP_060828

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000292808 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000292808 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000292808 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000292808 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000292808 MI0000479 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
ENST00000292808 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000292808 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000292808 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000292808 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000292808 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000292808 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000292808 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000292808 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000292808 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000292808 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000292808 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000292808 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000292808 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000292808 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000292808 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000292808 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000292808 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000292808 MI0000736 hsa-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENST00000292808 MI0000254 hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENST00000292808 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000292808 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000292808 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000292808 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000292808 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000292808 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000292808 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000292808 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000292808 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000292808 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000292808 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000292808 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000292808 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENST00000292808 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000292808 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000292808 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000292808 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000292808 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000292808 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000292808 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENST00000292808 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000292808 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENST00000292808 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENST00000292808 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000292808 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000292808 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000292808 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000292808 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000292808 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENST00000292808 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENST00000292808 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000292808 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000292808 MI0000093 hsa-miR-92a-1* AGGUUGGGAUCGGUUGCAAUGCU
ENST00000292808 MI0000094 hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC
ENST00000292808 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000292808 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000292808 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000292808 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000292808 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000292808 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000292808 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000292808 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000292808 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000292808 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000292808 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENST00000292808 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000292808 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000292808 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCF3 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACIN1 ABCF3 / ACIN1 Two-hybrid Stelzl U (2005)
DLEU1 DLEU1 / ABCF3 Two-hybrid Stelzl U (2005)
DNALI1 ABCF3 / DNALI1 Two-hybrid Stelzl U (2005)
FLJ20625 ABCF3 / FLJ20625 Two-hybrid Stelzl U (2005)
TOE1 ABCF3 / TOE1 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  2. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  7. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702