26-29kD-proteinase | GeneID:553225 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 553225 Official Symbol 26-29kD-proteinase
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description 26-29kD-proteinase protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_682877 XP_687969

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000051733 MI0002003 dre-miR-140 CAGUGGUUUUACCCUAUGGUAG
ENSDART00000051733 MI0004767 dre-miR-723 AAGACAUCAAUUAAAUCUGUGCU
ENSDART00000051733 MI0001360 dre-miR-7b UGGAAGACUUGUGAUUUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932