abhd4 | GeneID:550276 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 550276 Official Symbol abhd4
Locus N/A Gene Type protein-coding
Synonyms zgc:110267
Full Name abhydrolase domain containing 4
Description abhydrolase domain containing 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56937

ID Symbol Protein Species
GeneID:35733 CG1882 NP_610326.1 Drosophila melanogaster
GeneID:63874 ABHD4 NP_071343.2 Homo sapiens
GeneID:105501 Abhd4 NP_598837.1 Mus musculus
GeneID:178877 C37H5.3 NP_504297.1 Caenorhabditis elegans
GeneID:183295 C37H5.2 NP_504299.2 Caenorhabditis elegans
GeneID:364380 Abhd4 XP_344404.3 Rattus norvegicus
GeneID:452784 ABHD4 XP_509839.2 Pan troglodytes
GeneID:509896 ABHD4 NP_001029540.1 Bos taurus
GeneID:550276 abhd4 NP_001017613.1 Danio rerio
GeneID:607421 ABHD4 XP_848701.1 Canis lupus familiaris
GeneID:828516 AT4G24160 NP_194147.2 Arabidopsis thaliana
GeneID:853007 YGR110W NP_011625.1 Saccharomyces cerevisiae
GeneID:1272375 AgaP_AGAP000784 XP_311323.2 Anopheles gambiae
GeneID:2542281 SPAC6G10.03c NP_594100.1 Schizosaccharomyces pombe
GeneID:2684333 MGG_06157 XP_369307.1 Magnaporthe grisea
GeneID:2708061 NCU06332.1 XP_326187.1 Neurospora crassa
GeneID:2897074 KLLA0B12914g XP_452106.1 Kluyveromyces lactis
GeneID:4347605 Os09g0520200 NP_001063697.1 Oryza sativa
GeneID:4619020 AGOS_ABL019W NP_982928.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001017613 NP_001017613

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000034069 MI0001984 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000034069 MI0001985 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000034069 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000034069 MI0001987 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000034069 MI0001988 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000034069 MI0002004 dre-miR-141 UAACACUGUCUGGUAACGAUGC
ENSDART00000034069 MI0002015 dre-miR-148 UCAGUGCAUUACAGAACUUUGU
ENSDART00000034069 MI0002017 dre-miR-152 UCAGUGCAUGACAGAACUUUGG
ENSDART00000034069 MI0001897 dre-miR-17a* ACUGCAGUGGAGGCACUUCUAG
ENSDART00000034069 MI0002026 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000034069 MI0003243 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000034069 MI0001900 dre-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSDART00000034069 MI0001902 dre-miR-18c UAAGGUGCAUCUUGUGUAGUUA
ENSDART00000034069 MI0002037 dre-miR-200a UAACACUGUCUGGUAACGAUGU
ENSDART00000034069 MI0002038 dre-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENSDART00000034069 MI0002039 dre-miR-200c UAAUACUGCCUGGUAAUGAUGC
ENSDART00000034069 MI0001907 dre-miR-20a* ACUGCAGUGUGAGCACUUGAAG
ENSDART00000034069 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000034069 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000034069 MI0001384 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000034069 MI0001385 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000034069 MI0002054 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000034069 MI0002059 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000034069 MI0002060 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000034069 MI0002061 dre-miR-301b CAGUGCAAUAGUAUUGUCAUUG
ENSDART00000034069 MI0002062 dre-miR-301c CAGUGCAAUAGUAUUGUCAUAG
ENSDART00000034069 MI0004774 dre-miR-34c AGGCAGUGCAGUUAGUUGAUUAC
ENSDART00000034069 MI0001720 dre-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSDART00000034069 MI0002076 dre-miR-454b UAGUGCAAUAUUGCUUAUAGGG
ENSDART00000034069 MI0004922 xtr-miR-33a GUGCAUUGUAGUUGCAUUG
ENSDART00000034069 MI0004923 xtr-miR-33b GUGCAUUGUUGUUGCAUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] McPartland JM, et al. (2007) "A shifted repertoire of endocannabinoid genes in the zebrafish (Danio rerio)." Mol Genet Genomics. 277(5):555-570. PMID:17256142
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932