acer1 | GeneID:550266 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 550266 Official Symbol acer1
Locus DKEY-240A9.2 Gene Type protein-coding
Synonyms asah3; zgc:110285
Full Name alkaline ceramidase 1
Description alkaline ceramidase 1
Chromosome N/A
Also Known As N-acylsphingosine amidohydrolase 3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15853

ID Symbol Protein Species
GeneID:125981 ASAH3 NP_597999.1 Homo sapiens
GeneID:171168 Asah3 NP_783858.1 Mus musculus
GeneID:301118 Asah3 XP_236790.3 Rattus norvegicus
GeneID:420088 ASAH3 XP_418208.2 Gallus gallus
GeneID:468681 ASAH3 XP_524068.2 Pan troglodytes
GeneID:518021 ASAH3 XP_596203.2 Bos taurus
GeneID:550266 zgc:110285 NP_001017603.1 Danio rerio
GeneID:611739 ASAH3 XP_854540.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0017040 Function ceramidase activity
GO:0016787 Function hydrolase activity
GO:0016811 Function hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides
GO:0006672 Process ceramide metabolic process
GO:0006629 Process lipid metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001017603 NP_001017603

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000023797 MI0001984 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000023797 MI0001985 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000023797 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000023797 MI0001987 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000023797 MI0001988 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000023797 MI0003693 dre-miR-139 UCUACAGUGCAUGUGUCU
ENSDART00000023797 MI0001380 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000023797 MI0003387 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000023797 MI0001366 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000023797 MI0001367 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000023797 MI0002024 dre-miR-181c CACAUUCAUUGCUGUCGGUGGG
ENSDART00000023797 MI0001382 dre-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSDART00000023797 MI0002047 dre-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSDART00000023797 MI0001386 dre-miR-220 CCACAACCGUAUCGGACACUU
ENSDART00000023797 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000023797 MI0001923 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000023797 MI0001925 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000023797 MI0001926 dre-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSDART00000023797 MI0001927 dre-miR-26b UUCAAGUAAUCCAGGAUAGGUU
ENSDART00000023797 MI0001930 dre-miR-27c UUCACAGUGGUUAAGUUCUGC
ENSDART00000023797 MI0002059 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000023797 MI0002060 dre-miR-301a CAGUGCAAUAGUAUUGUCAAAG
ENSDART00000023797 MI0002061 dre-miR-301b CAGUGCAAUAGUAUUGUCAUUG
ENSDART00000023797 MI0002062 dre-miR-301c CAGUGCAAUAGUAUUGUCAUAG
ENSDART00000023797 MI0002067 dre-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSDART00000023797 MI0002176 dre-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSDART00000023797 MI0004770 dre-miR-726 UUCACUACUAGCAGAACUCGG
ENSDART00000023797 MI0001951 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000023797 MI0001952 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000023797 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000023797 MI0004880 xtr-miR-367 AAUUGCACUGUAGCAAUGGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932