ACPP | GeneID:55 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 55 Official Symbol ACPP
Locus N/A Gene Type protein-coding
Synonyms ACP-3; ACP3; PAP
Full Name acid phosphatase, prostate
Description acid phosphatase, prostate
Chromosome 3q21-q23
Also Known As prostatic acid phosphotase
Summary This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55552

ID Symbol Protein Species
GeneID:55 ACPP NP_001090.2 Homo sapiens
GeneID:56318 Acpp NP_997551.1 Mus musculus
GeneID:56780 Acpp NP_064457.1 Rattus norvegicus
GeneID:460702 ACPP XP_001148736.1 Pan troglodytes
GeneID:485662 ACPP XP_542782.2 Canis lupus familiaris
GeneID:504700 ACPP XP_580862.3 Bos taurus
GeneID:776390 ACPP XP_001235914.1 Gallus gallus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab61707 Prostatic Acid Phosphatase antibody [LT3D1] (ab61707); Mouse monoclonal [LT3D1] to Prostatic Acid Phosphatase
2 abcam ab17793 Prostatic Acid Phosphatase antibody [SPM312], prediluted (ab17793); Mouse monoclonal [SPM312] to Prostatic Acid Phosphatase, prediluted
3 abcam ab14192 Prostatic Acid Phosphatase antibody (ab14192); Goat polyclonal to Prostatic Acid Phosphatase
4 abcam ab9381 Prostatic Acid Phosphatase antibody (ab9381); Rabbit polyclonal to Prostatic Acid Phosphatase
5 abcam ab915 Prostatic Acid Phosphatase antibody [PASE/4LJ], prediluted (ab915); Mouse monoclonal [PASE/4LJ] to Prostatic Acid Phosphatase, prediluted
6 abcam ab947 Prostatic Acid Phosphatase antibody, prediluted (ab947); Rabbit polyclonal to Prostatic Acid Phosphatase, prediluted
7 abgent AP7592b ACPP Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abnova H00000055-M01 ACPP monoclonal antibody (M01), clone 2D11; Mouse monoclonal antibody raised against a partial recombinant ACPP.
9 acris AP14250PU-N ACPP / Prostatic acid phosphatase (C-term); antibody Ab
10 acris AP02196SU-S ACPP / Prostatic acid phosphatase; antibody Ab
11 acris DM085 ACPP / Prostatic acid phosphatase; antibody Ab
12 acris AP02196SU-N ACPP / Prostatic acid phosphatase; antibody Ab
13 acris AM05054SU-N ACPP / Prostatic acid phosphatase; antibody
14 scbt ACPP ACPP Antibody / ACPP Antibodies;
15 sigma P9808 Monoclonal Anti-Prostatic Acid Phosphatase, Human antibody produced in mouse ;
16 sigma P5664 Anti-Prostatic Acid Phosphatase antibody produced in rabbit ;
17 sigma P5687 Monoclonal Anti-Prostatic Acid Phosphatase, Human antibody produced in mouse ;
18 sigma HPA004335 Anti-ACPP antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACPP Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACPP Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005765 Component lysosomal membrane
GO:0016020 Component membrane
GO:0003993 Function acid phosphatase activity
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001099  UCSC Browser NP_001090
2 NM_001134194  UCSC Browser NP_001127666

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000351273 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENST00000351273 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000351273 MI0000102 hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG
ENST00000351273 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000351273 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000351273 MI0000267 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU
ENST00000351273 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000351273 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000351273 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000351273 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000351273 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000351273 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000351273 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000351273 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000351273 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000351273 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000351273 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000351273 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000351273 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000351273 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000351273 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000351273 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000351273 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000351273 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000351273 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000351273 MI0000290 hsa-miR-214* UGCCUGUCUACACUUGCUGUGC
ENST00000351273 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000351273 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000351273 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000351273 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000351273 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000351273 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000351273 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000351273 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000351273 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENST00000351273 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000351273 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENST00000351273 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENST00000351273 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENST00000351273 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENST00000351273 MI0003605 hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC
ENST00000351273 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000351273 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000351273 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENST00000351273 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000351273 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000351273 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000351273 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENST00000351273 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000351273 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000351273 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000351273 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000351273 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000351273 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENST00000351273 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000351273 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENST00000351273 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENST00000351273 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENST00000351273 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENST00000351273 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENST00000351273 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA
ENST00000351273 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACPP mRNA
17602206
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACPP mRNA
17602206
Ellagic Acid
  • Ellagic Acid results in increased expression of ACPP mRNA
12002526
Estradiol
  • [Progesterone co-treated with Estradiol] results in decreased expression of ACPP mRNA
17404688
Progesterone
  • Progesterone results in decreased expression of ACPP mRNA
  • [Progesterone co-treated with Estradiol] results in decreased expression of ACPP mRNA
17404688

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 14630087, 17018787, 18497071
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10737359, 11831363, 17428255, 10672840
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 18648771, 10737359, 16942905, 15885732, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Liver Neoplasms inferred via Clofibric Acid 17602206

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACPP ACPP / ACPP Co-crystal Structure LaCount MW (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zylka MJ, et al. (2008) "Prostatic acid phosphatase is an ectonucleotidase and suppresses pain by generating adenosine." Neuron. 60(1):111-122. PMID:18940592
  2. [ + ] Erbas H, et al. (2007) "Prostatic acid phosphatase in breast cyst fluid." Malays J Pathol. 29(2):95-99. PMID:19108401
  3. [ + ] Quintero IB, et al. (2007) "Prostatic acid phosphatase is not a prostate specific target." Cancer Res. 67(14):6549-6554. PMID:17638863
  4. [ + ] Klyushnenkova EN, et al. (2007) "Identification of HLA-DRB1*1501-restricted T-cell epitopes from human prostatic acid phosphatase." Prostate. 67(10):1019-1028. PMID:17455230
  5. [ + ] Sharma S, et al. (2005) "Theoretical investigations of prostatic acid phosphatase." Proteins. 58(2):295-308. PMID:15578709
  6. [ + ] Pope SN, et al. (2005) "Yeast two-hybrid identification of prostatic proteins interacting with human sex hormone-binding globulin." J Steroid Biochem Mol Biol. 94(1-3):203-208. PMID:15862967
  7. [ + ] Stewart LV, et al. (2005) "Vitamin D receptor agonists induce prostatic acid phosphatase to reduce cell growth and HER-2 signaling in LNCaP-derived human prostate cancer cells." J Steroid Biochem Mol Biol. 97(1-2):37-46. PMID:16076555
  8. [ + ] Johnson JL, et al. (2005) "The Rab27a-binding protein, JFC1, regulates androgen-dependent secretion of prostate-specific antigen and prostatic-specific acid phosphatase." Biochem J. 391(Pt 3):699-710. PMID:16004602
  9. [ + ] Shan J, et al. (2005) "GAAAATATGATA-like elements in androgen-associated regulation of the prostatic acid phosphatase gene." J Steroid Biochem Mol Biol. 96(3-4):245-249. PMID:15985366
  10. [ + ] Tanaka M, et al. (2004) "Prostatic acid phosphatase degrades lysophosphatidic acid in seminal plasma." FEBS Lett. 571(1-3):197-204. PMID:15280042
  11. [ + ] Zelivianski S, et al. (2004) "Transcriptional activation of the human prostatic acid phosphatase gene by NF-kappaB via a novel hexanucleotide-binding site." Nucleic Acids Res. 32(12):3566-3580. PMID:15240830
  12. [ + ] Shan J, et al. (2003) "Tissue-specific expression of the prostatic acid phosphatase promoter constructs." Biochem Biophys Res Commun. 311(4):864-869. PMID:14623260
  13. [ + ] Marquinez AC, et al. (2003) "Identification of gp17 glycoprotein and characterization of prostatic acid phosphatase (PAP) and carboxypeptidase E (CPE) fragments in a human seminal plasma fraction interacting with concanavalin A." J Protein Chem. 22(5):423-429. PMID:14690244
  14. [ + ] Luchter-Wasylewska E, et al. (2003) "Concentration-dependent dissociation/association of human prostatic acid phosphatase." J Protein Chem. 22(3):243-247. PMID:12962324
  15. [ + ] Wojciak P, et al. (2003) "Equilibrium unfolding of dimeric human prostatic acid phosphatase involves an inactive monomeric intermediate." Int J Biol Macromol. 32(1-2):43-54. PMID:12719131
  16. [ + ] Ortlund E, et al. (2003) "Crystal structures of human prostatic acid phosphatase in complex with a phosphate ion and alpha-benzylaminobenzylphosphonic acid update the mechanistic picture and offer new insights into inhibitor design." Biochemistry. 42(2):383-389. PMID:12525165
  17. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  18. [ + ] Brillard-Bourdet M, et al. (2002) "Amidolytic activity of prostatic acid phosphatase on human semenogelins and semenogelin-derived synthetic substrates." Eur J Biochem. 269(1):390-395. PMID:11784334
  19. [ + ] Dulinska J, et al. (2002) "Comparative analysis of prostatic acid phosphatase and prostate-specific antigen mRNA levels in hyperplastic prostate stimulated with steroid hormones and growth factors." Acta Biochim Pol. 49(2):357-368. PMID:12362977
  20. [ + ] Zelivianski S, et al. (2002) "Identification and characterization of regulatory elements of the human prostatic acid phosphatase promoter." Oncogene. 21(23):3696-3705. PMID:12032838
  21. [ + ] Waheed A, et al. (2002) "Protection of prostatic acid phosphatase activity in human serum samples by plasmin inhibitors." Clin Chim Acta. 320(1-2):127-131. PMID:11983210
  22. [ + ] Inoue Y, et al. (2001) "Induction of tumor specific cytotoxic T lymphocytes in prostate cancer using prostatic acid phosphatase derived HLA-A2402 binding peptide." J Urol. 166(4):1508-1513. PMID:11547122
  23. [ + ] Bem S, et al. (2001) "Effect of tartaric acid on conformation and stability of human prostatic phosphatase: an infrared spectroscopic and calorimetric study." Acta Biochim Pol. 48(3):755-762. PMID:11833784
  24. [ + ] Zhang XQ, et al. (2001) "Characterization of a prostate-specific tyrosine phosphatase by mutagenesis and expression in human prostate cancer cells." J Biol Chem. 276(4):2544-2550. PMID:11067847
  25. [ + ] Fong L, et al. (2001) "Dendritic cell-based xenoantigen vaccination for prostate cancer immunotherapy." J Immunol. 167(12):7150-7156. PMID:11739538
  26. [ + ] Chang SS, et al. (2001) "Comparison of anti-prostate-specific membrane antigen antibodies and other immunomarkers in metastatic prostate carcinoma." Urology. 57(6):1179-1183. PMID:11377343
  27. [ + ] Meng TC, et al. (2000) "Interaction between protein tyrosine phosphatase and protein tyrosine kinase is involved in androgen-promoted growth of human prostate cancer cells." Oncogene. 19(22):2664-2677. PMID:10851066
  28. [ + ] Jakob CG, et al. (2000) "Crystal structure of human prostatic acid phosphatase ." Prostate. 42(3):211-218. PMID:10639192
  29. [ + ] Tsai DY, et al. (1999) "The age of the urologist affects the postoperative care of prostate carcinoma patients." Cancer. 86(7):1314-1321. PMID:10506719
  30. [ + ] Chan PS, et al. (1999) "In situ hybridization study of PSP94 (prostatic secretory protein of 94 amino acids) expression in human prostates." Prostate. 41(2):99-109. PMID:10477906
  31. [ + ] Jin B, et al. (1999) "Effects of liver disease and transplantation on the human prostate." J Androl. 20(4):559-565. PMID:10452601
  32. [ + ] Meng TC, et al. (1998) "Tyrosine phosphorylation of c-ErbB-2 is regulated by the cellular form of prostatic acid phosphatase in human prostate cancer cells." J Biol Chem. 273(34):22096-22104. PMID:9705354
  33. [ + ] LaCount MW, et al. (1998) "Structural origins of L(+)-tartrate inhibition of human prostatic acid phosphatase." J Biol Chem. 273(46):30406-30409. PMID:9804805
  34. [ + ] Safa AA, et al. (1998) "Undetectable serum prostate-specific antigen associated with metastatic prostate cancer: a case report and review of the literature." Am J Clin Oncol. 21(4):323-326. PMID:9708626
  35. [ + ] Lovelace L, et al. (1997) "Prostatic acid phosphatase: structural aspects of inhibition by L-(+)-tartrate ions." Acta Biochim Pol. 44(4):673-678. PMID:9584847
  36. [ + ] Darson MF, et al. (1997) "Human glandular kallikrein 2 (hK2) expression in prostatic intraepithelial neoplasia and adenocarcinoma: a novel prostate cancer marker." Urology. 49(6):857-862. PMID:9187691
  37. [ + ] Sharief FS, et al. (1994) "Nucleotide sequence of human prostatic acid phosphatase ACPP gene, including seven Alu repeats." Biochem Mol Biol Int. 33(3):561-565. PMID:7951074
  38. [ + ] Virkkunen P, et al. (1994) "Structural comparison of human and rat prostate-specific acid phosphatase genes and their promoters: identification of putative androgen response elements." Biochem Biophys Res Commun. 202(1):49-57. PMID:8037752
  39. [ + ] Ostrowski WS, et al. (1994) "Human prostatic acid phosphatase: selected properties and practical applications." Clin Chim Acta. 226(2):121-129. PMID:7923807
  40. [ + ] Ostanin K, et al. (1994) "Heterologous expression of human prostatic acid phosphatase and site-directed mutagenesis of the enzyme active site." J Biol Chem. 269(12):8971-8978. PMID:8132635
  41. [ + ] Banas B, et al. (1994) "Analysis of the promoter of the human prostatic acid phosphatase gene." Biochim Biophys Acta. 1217(2):188-194. PMID:8110833
  42. [ + ] Lindqvist Y, et al. (1993) "Three-dimensional structure of rat acid phosphatase in complex with L(+)-tartrate." J Biol Chem. 268(28):20744-20746. PMID:8407898
  43. [ + ] Li SS, et al. (1993) "The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23." Genomics. 17(3):765-766. PMID:8244395
  44. [ + ] Sharief FS, et al. (1992) "Structure of human prostatic acid phosphatase gene." Biochem Biophys Res Commun. 184(3):1468-1476. PMID:1375464
  45. [ + ] Van Etten RL, et al. (1991) "Covalent structure, disulfide bonding, and identification of reactive surface and active site residues of human prostatic acid phosphatase." J Biol Chem. 266(4):2313-2319. PMID:1989985
  46. [ + ] Nguyen L, et al. (1990) "Prostatic acid phosphatase in serum of patients with prostatic cancer is a specific phosphotyrosine acid phosphatase." Clin Chem. 36(8 Pt 1):1450-1455. PMID:1696855
  47. [ + ] Tailor PG, et al. (1990) "Nucleotide sequence of human prostatic acid phosphatase determined from a full-length cDNA clone." Nucleic Acids Res. 18(16):4928. PMID:2395659
  48. [ + ] Kamoshida S, et al. (1990) "Extraprostatic localization of prostatic acid phosphatase and prostate-specific antigen: distribution in cloacogenic glandular epithelium and sex-dependent expression in human anal gland." Hum Pathol. 21(11):1108-1111. PMID:1699876
  49. [ + ] Sharief FS, et al. (1989) "Human prostatic acid phosphatase: cDNA cloning, gene mapping and protein sequence homology with lysosomal acid phosphatase." Biochem Biophys Res Commun. 160(1):79-86. PMID:2712834
  50. [ + ] Vihko P, et al. (1988) "Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase." FEBS Lett. 236(2):275-281. PMID:2842184